Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4506
Length(NT) : 1296
Best Gene Model Blast : Link to GSTUMT00006913001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: alpha-L-rhamnosidase
Accession: ref|YP_001634000.1| Score: 928 E_value: 4e-98
KEGG Definition: alpha-L-rhamnosidase
Accession: cau:Caur_0361 Score: 928 E_value: 2e-98
KOG Definition: No Hit Found
PFAM Definition: Bac_rhamnosid_N, Alpha-L-rhamnosidase N-terminal domain. This family consists of bacterial rhamnosidase A and B enzymes. This domain is probably involved in substrate recognition..
Pfam Number: pfam08531 Score: 644 E_value: 9e-68

Sequence:
>Contig4506
TTGGACCAGCCAAAACCCCAGATCCGTAATGTCGGTAGACTCCATTACCT
TTGACCGCCAACGCCCGACTAAACACCTCCTCTCGGCCCCCTCCAAATCC
CCGACTTTATCTTGGAGAACTACGCCTAATAAATCCGATTGGCAGCAGAC
AACTTATCAAATCCGGCTGGACCGTCCGGACTGGCAACCAACTACCTACT
ACGTCAATTCCGCCGCTAGTGTCGCAGTAACATGGCCCGGGGCAGATATC
TCCTCGAGGGAGATTGTCAACGTAAAAGTCGCTGTGCGTGGGGTTGGCGA
GGAACAAGATGTATGGTCTAATGAGGTCAGTGTCGAGGGGGGGTTATTTG
AACAGGAGGATTGGAGTGCTGTGCCGATATGTGCTGTTGGAGTGGCGGAC
TTGACTGGGAGGGTACCAGTCACTTTATTGAGGAAGGAGTTTACATTGAG
GGATGGGGATAAAATGGTCAAGAGGGCGAGGTTGTATGTTACGGCGCTGG
GGGTTTATGAGGTCGAGATTAATGGGAGGAAGGTTGGAGATGAGGAATTT
GCGCCCGGGTGGACGAGTTATGGGCATCGGATCAAGTACCAGACGTTTGA
CGTTGCGGACTTACTCCGTAAAGGGGAGAATGCTGTGGGGGCGTATTTGG
GGGAGGGGTGGTATAGAGGGAGGATAGGGTTTGAAGGGGGTAGAACAGCG
ATATACGGAAAGGATATCGGATTGATATTCCAGTTGGAGATTACCTACGA
GGACGATACGGTTACCAAAGTTGTCTCGGATGATTCGTGGAAAGCTTCAA
CGGGGGCCATTCTCTATTCAGAGATTTACGATGGGGAATTTTATGACGCG
CGGAAGGAGAAGCCCGGATGGTCTTCACCGGGGTATACCGGATCCAGTGA
CTGGAAAGCCGTACGAGAACTACCGTTCCCCACCGCAGCTCTAGTGTCTC
CACCCGGGCCACCAGTCCGCTGCACCGAGATAGTAGCCCCCGTAAAAGTC
TTTACAACCCCATCCGGAAAGACGGTAGTAGATTTTGGACAAAACCTCGT
AGGCCGCCTGCGAATCAAGCTCTGCGGCCCCTCTGGTCACAAAGTCACCT
TCACCCACACTGAAGTTCTCGAAAAGTCCGGAGAGGTGGCGACTCGGCCG
CTCCGTGCAGCACAATGCACCGACCACTACATCATGAAGGGTAGCGACGA
ACCGGAAACCTACGAGCCGAAATTTACATTCCACGGCTTCCGCTACGTTC
AGGTGGATAATTGGCCTCCAATCTCGGACCTCCTAAAAAGCGTGGA

Sequences in the Contig:

SY0AAC34YF20FM1 SY0AAC60YB01FM1 SY0AAD19YF06FM1
SY0AAD33YA14FM1 SY0AAD58YG15FM1