Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4505
Length(NT) : 1164
Best Gene Model Blast : Link to GSTUMT00009161001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: Amidohydrolase 2
Accession: ref|YP_373709.1| Score: 381 E_value: 1e-34
KEGG Definition: amidohydrolase 2 [EC:4.1.1.45]; K03392 aminocarboxymuconate-semialdehyde decarboxylase
Accession: bur:Bcep18194_B2954 Score: 381 E_value: 5e-35
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG4245 Score: 180 E_value: 4e-14
PFAM Definition: Amidohydro_2, Amidohydrolase. These proteins are amidohydrolases that are related to pfam01979..
Pfam Number: pfam04909 Score: 185 E_value: 1e-14
Swissprot: Q8R5M5|ACMSD_RAT
Gene Ontology:
GO:0001760 = Molecular function: aminocarboxymuconate-semialdehyde decarboxylase activity

Sequence:
>Contig4505
TTGGCTTACCCCTTTCTTACAGTCATCTTTCCAGAAAGCCACCTTTGGAT
AGAAAAAAAATGAACGCTTCAACGGCATTTATAGGGCCTGGGAGAATTGA
TACACATCACCACTACTTCGGGGACTCGGTCCCAGAACTGGTATCAGAAT
TCACAAACGATGGAGCTCAAGCCTTCTTCTTCCCAAAGGGCGTGGACGAC
CACTTGAAGTACATGGATTCCATGGGAATCCAGACGGCCGTACTGGCGCC
AAGTATCAAGATGGAATGGCATACCCAATGGCCACCGGCGAGATGGAAGA
ACCTGTGCGAGAGGACGCTGAAAGCCCAGCTGAAGGTTCAGGAATCGAAT
CCGCTCCGCTTTGGGACGTTTGCCATGCTCCCCTTCCCGCATGTTAACGA
GACTTTGGACTTCGTGAGGGATATATACACCCGTGAGGTCAAGCCAGATG
GTTTCGCGCTGTCTACGGCTATGGGGAATAAATACCTCGGTGATCCAGCC
TTCGATCCCATGTGGGACGAATTGAATATGCATAGCGCAGCGATTTTCGT
CCACCCTGCGGACACTGCAATGCCGCCGGGACTGGAGTATAAGCCATACG
TGTTCGAATATGCCTTCGACACAGCCCGTGCTATGGCCAGCACCATAATC
AACGGCGTGTTCACCCGCTATCCGAACCTCAAATTCATCTTCTCCCACAA
CGGCGGCGCATTCCCGTTCATGGCGAAACGCCTGGACGACGTCGGCCCCT
CTGCTAAAAAGATGAACAACGGAAAGTCGGTGTTCGAGGTGATCAGGACG
AGCAACATCTTCGTCGACACCGCCATTTCCGCCCCGATACAGTGGCCGGT
AACGCTGGACATTGGCTTCCCCGTAGAACGCATAATATATGCGTCGGATT
ATCCGTACACGGCCGCTGTCGGTGAGGTTGCATATCACGGGAAAACGGCC
CCGGAGGAGTCCGGACAATTCACGAGGCACGAGTTGGATGTTAAGATCGC
CCGTGAGAATGCTTTGAAAGGACTTTTCCCGAGACTGGCTGTGGAGTACA
AGAAGGCGTTTGGGCACAAAGTTGACTGCTGAGTCGGAGTAGTTGCTGGA
TGAATGGGTGTTTTCGGGATGTGGAGTACTTAAAAGCGAAGGCATGTGCT
CGAATTGATATTTG

Sequences in the Contig:

SY0AAC16YE10FM1 SY0AAC27YA16FM1 SY0AAC34YF19FM1
SY0AAD13YH10FM1 SY0AAD42YL13FM1 SY0AAD60YJ16FM1
SY0AAD9YA12FM1 SY0AAD9YJ17FM1