Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4503
Length(NT) : 504
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4503
TTGGGCCACCGCATCCTTTGCACAGCGATCGGTTCCTCACCTGTGCGAAC
TCTCTTTTGTTGCTGGCATAACAGGCTCAGTTCGCATGCATATTGAATGC
ACTGAATACTTCCGGACAAATCACCGGCTTGCCGGTGGGATCCCGATGCG
GTGGGAACTCAGTATCATACCTTATCACCACAACCCCCTACAGAAGATGT
CTTTTGGGAATACGGGAAGAACTCGGACAAAGCTCTGCTTTCGCAGCAGC
CGGGGATGTATCATTACCCATCACTCGAGACGCGCGGATAGGTGGCCTCG
CCGAATACCCTCTAGGTATTCCATCAGTTATGTAGCAACTGGCTCGTCTA
CAGCACCCAGGGTTATTGTTCCAGGTCCGTAAGACACTTATTGTGGGTAT
GATATCAGAGTATGGGGGGGGGGGACTGGCTATCATACCAAAAACGGGAT
GGGGATGGGATGTCGATAAAGTGTTTTCTGAGAAGGGGGGGTGGCATATA
TGCC

Sequences in the Contig:

SY0AAC34YE23FM1 SY0AAD43YK16FM1