Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4502
Length(NT) : 904
Best Gene Model Blast : Link to GSTUMT00010996001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE57037.1| Score: 367 E_value: 3e-33
KEGG Definition: ankyrin repeat
Accession: aor:AO090001000528 Score: 367 E_value: 1e-33
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q00808|HETE1_PODAN

Sequence:
>Contig4502
TTGGCGATGACTTACTTTAGTCAGAATACGAACTCTTTCAATACCACCAC
CATCATTGACACTGTGCTCATTACGAGTGCTGACGGAAGAGCCGAACTTC
TGTCCTGGCTTTCTCCACTGGAACCTCAGACGAGGCACCAGGATGTGCGT
ATACGGCGGTACGATGGTATAGGGGATTGGCTTTTGGAGACAGCTGAATT
CACAAGATGGCGAAATGGTCATGATGGGTCCTCTGTTCTTTACGTTTCTG
GAGCCCCGGGGGCTGGAAAGACTTATTTAAGTTCCCTAGTTGTCGACACC
ATTTGTAACGAGAATCGAGAGCAACATGTGGGAGTAGCTTGCTTGTACGT
CGATTTTCTTGAACAGGAAGACTGGTCCGTAACAAACATGATTGGCGCCA
TCCTCAAGCAGTTTGTGGTTGCGTTGCCTAAGATTCCTAAAGAAATCTAC
CAAGATTTCCTGAGTTCAACGGAGCATCTAGGAGGACGAGGCCTTTGCCT
CCCGGAGTTGATTCGGATGTTCCGGATTGTTTTGCCGTCTTTCCAGCGTA
CCTACATATGCATTGATGCCTTGGATGAAATCCATGTGGCAAAGCGGCCC
GAACTTCTCAAGTCTCTGGACCAAATCATCCAGAATTCGCCTGGGGCCCG
GCTGTTTATCACTGGCAGACCGCATATCAGGGAGGAGCTCGAAAGGCACC
TCATGGGATCCGTGAATTGTGTAATTTTTCAGCCGAGCCAGCGGGATATC
AGGAAGTACCTGGCTTCTAGGTTGCAGTCTGACCCGGAGCCGGGATCAAT
GGATGAAAAATTGGAGTCAGAGATCATGACTAAGATTCCTGAAAATTTTT
CTGATATGTTCCTGCTCGTTTTCTTGCATTTCGAAGCTATTTTGGGAGAG
ACGA

Sequences in the Contig:

SY0AAC34YE19FM1 SY0AAD28YC01FM1 SY0AAD57YJ22FM1