Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4501
Length(NT) : 1456
Best Gene Model Blast : Link to GSTUMT00006876001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein SNOG_09570
Accession: ref|XP_001799859.1| Score: 908 E_value: 1e-95
KEGG Definition: hypothetical protein [EC:3.2.1.52]; K01207 beta-N-acetylhexosaminidase
Accession: mgr:MGG_09922 Score: 848 E_value: 5e-89
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG2499 Score: 537 E_value: 3e-55
PFAM Definition: Glyco_hydro_20, Glycosyl hydrolase family 20, catalytic domain. This domain has a TIM barrel fold..
Pfam Number: pfam00728 Score: 572 E_value: 2e-59
Swissprot: P07686|HEXB_HUMAN
Gene Ontology:
GO:0004563 = Molecular function: beta-N-acetylhexosaminidase activity
GO:0046982 = Molecular function: protein heterodimerization activity
GO:0042803 = Molecular function: protein homodimerization activity

Sequence:
>Contig4501
TTGGCCGCATCGTACGATATTTAAAAGGCAAGCTGTGGCCCGGTGTTTTC
TCTTCCTCGTTCTCACTGTCTTGTCCTACTCCCGATTATTATTAGGTTTA
TAATTCTTATATTTCTGTCACTTTTTCCTTCTTTATTTCGTTGGAGTGTG
GGTGAGTGATACTTGCGGTGAAGAAGGAAGGGAGAATGATTTCAAAATTC
ATCATAGCAACAGCATTGCTAACGTTCATGACATCCGTCACTGCGCTCTG
GCCTATCCCCGAGAGCTACAAACATGGCGATACCACAGTTTGGTTATCGC
CGGGCGTGGAATTGGTTTTCGATTCGCCCCCCGAAACACGAACAGCCACA
AAACACAAAGTCCACGAGGCCTGGAGCCGCACCCGGGACATAATATTCCA
GGAACGCTTAGTCCCCTGGAAATTTTACCCCCGTGGGGCCAAATTCGAAC
CGGAAAACAAGTTCGGCGGGGTGATCAAGAAGGTATTCGTCAGACAGACA
TCCGTGGACAAGCCGGAGCCTGTGCCCTATGGAGAATTCGATGAGAGCTA
CACGCTCATAATCCCCATCTCTGGTGGGAACTTTACCTCTCTGGAGGCTA
ATGGGGTGGGAGCGACCCTCGATGAAGGGAGGGAGCCGGGAGCGGTCTAC
ATCACCGCTGGGTCAAGCCTGGGCGTGCTGCATGCCTTCACGACGCTCAG
TCAGCTATTCTACTACTCCAACAACCACCGCGACGGGGTGTACTCCAAAC
TCGCGCCGGTGGAAATAAACGACAAGCCCAAGTTCCAGCACCGCGGACTA
AACATGGACGTGGCGAGGCAATGGTACCCGAAGGAGGAAATCCTGAAGAT
CATCGACACCCTCTCCTGGAACAAAATGAACAGACTCCACCTGCACGTGA
CGGACTCGCAATCCTGGCCGCTGGAGATCCCCGCGATGCCGAACCTCGCG
GCAAGGGGCGCGTACGCGGATGGGCTGACCTACTCGCCGCAGGACCTGCA
GGACATACTAACCTGGGGCCGGTCGCGCGGCGTGGAGGTCATCGTGGAGA
TTGATATGCCGGGCCACACTACCTCCATCGCGGAGGCCTACCCGGAGCTC
ATCACGGGCAGGGACAAGCAGCCGGACTGGGATCAGTACGCTGCGCAACC
CCCCTCCGGCTCACTTAAGCTCCGCAACCCTGCCGTTAAAAAGTTCCTCA
CCACACTCTTCGACGACTTACTCCCAAGACTCAAGTCGCATAGCCAGTAC
TTCCACACGGGTGGCGATGAGGTCAATAAGAACGTGTACAAATTTGACGA
GAACATCAAATCCAACGACTCGGCCGTGCTTCAGCCCGCGCTGCAGGACT
TCCTCTCGCACGTGCACACCGAGTTGGGCCGGCACGGTGTCACACCCTTT
GTGTGGGAGGAAATGCTGCTCGAATGGAACCTGACGCTTCCCAAGGACTC
GATCGT

Sequences in the Contig:

SY0AAA48YE17FM1 SY0AAC16YO06FM1 SY0AAC34YE12FM1
SY0AAC60YE24FM1 SY0AAD11YP12FM1 SY0AAD58YB14FM1