Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4500
Length(NT) : 1082
Best Gene Model Blast : Link to GSTUMT00011293001 E-value : 3e-12
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4500
TTGGTGAACACGGCGACGACGATAGCAACGACACAACCGGTGGTTTTTCC
TACAGGATATAATAACAGCATTCATAATACTACATCTTCCATTCTTACAC
CAGGTAATTACCCTCCAGGAACCTATCCTACTGCACCTGCTACTAGTACC
ACTACCACCGCGGGCGACTGCAAGGACAACAAGCCAACTGCACCAATAAC
AACCCCAACTTCATCCACCCAACCCACTAGTATTATGCTCCCCCCAGCCC
CAACCCCACCCCGCAACACCACCAACCCCCTCGCAGAAGAACAACAGTCG
GGACAGGAATACCGAAGACCAATGCGGACAACCATGCGGGACGACCCCAA
ATACCAAGAGCAAAAAGAAGATGGCGGCAGAGCACTTCGGGGCGAAGCGG
AGAGAGAGCGGGACTTGAGATCTACTGTTGATAAGCAGCACGATAGTGAT
AGTGCCGGGGGGGATGTTGTGGACGAGAAGGGAGAGAATGCCGGTCTTTT
CGGAAGGGTAGCAGAGAAGCTTGGGCATGCTTTGGGGGTTGAGACTTGAT
TAATGAATAATTGTTATTTTTGCTTTCTTGTTCTCTTGTTTGGTTGTTGT
GGTTGGTTAGTTAGGGGTTCTTGGGGTGGTGGGTGGATGGCTGGGGATAA
TAATGTGGATGTGAAAGTGTATGATGTTCCGACACTCTTTTTTTCACTCT
TTTAACACGAACACAATGTGTCCTCCATAATTGAATGTATAACTCTAGTC
TTGTTCAAGAGAGCGCGCGCGCACACACTCTCTAAGTTTTGGCGCGATGA
TTGGGAGCGAGTGATGGAACGTGATCAGCCCCTAACCAACCGTTCTAGCA
CTTGTACTTCTAGCAAATAATACGATACTACGGCAGATATCCAGCCTTTT
TGTAAACCTAACCTACCGGGCAAAAATGCAAACCACTCTTTCAACCGCTC
AAGCAATCAATTAAGTTCAATTTATTAACCACCCACCGATCCCACCTAGC
TCGATGTAGTAGCATAACGTAGCTGGGTGAAATGTTCACACAATGGAAAG
AGAAGAGAAGGGAAAAGAGAAGGCAACTCCAA

Sequences in the Contig:

SY0AAC34YE10FM1 SY0AAD36YB13FM1 SY0AAD63YO18FM1