Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig450
Length(NT) : 457
Best Gene Model Blast : Link to GSTUMT00006855001 E-value : 1e-139
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG1924 Score: 108 E_value: 3e-06
PFAM Definition: FAP, Fibronectin-attachment protein (FAP). This family contains bacterial fibronectin-attachment proteins (FAP). Family members are rich in alanine and proline, are approximately 300 long, and seem to be restricted to mycobacteria. These proteins contain a fibronectin-binding motif that allows mycobacteria to bind to fibronectin in the extracellular matrix..
Pfam Number: pfam07174 Score: 105 E_value: 5e-06

Sequence:
>Contig450
GGAAGGAAATATATTTGTTTTATTTTTCTTGTGAAAAAAAAAAAAAAGGG
AAAAGGGGAAAAGGGGAAAAGGGGGAAAAGAAAAGATAATACTAGTCAGA
AATGTAAAAAAAGACAGGAGAAAAAAGTAAGCTCGTAGGTTACTTGTAGA
GCACTGAACTCGAGTACTCTATGATATAACAGAAGGGCAGACTATCAAAT
AGCGCTTACTCAATATACGACAATGCATTTTGATCCGCCTGCAGCGTGAG
CTGGTTACCATAGTGCAAGTTGGCCAAATTCTTTTCATTCATCGCGCACA
TGGCCTCCAAGTTCGCCCTGTGCATCTCGATCTGAGCCATCTGCGCGAAC
TCCATCTCCTGGAGGGCCAGGGCCTCCTGTGCCAGGGCCCACTCCCTCTG
GGCCTCCTCCTTCTCACGCTCCCGCTGCGCCAGTGCCTCCTGTACCATGG
CCCCCAA

Sequences in the Contig:

SY0AAA24YE16FM2 SY0AAA24YE16RM1