Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4499
Length(NT) : 1138
Best Gene Model Blast : Link to GSTUMT00010734001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein CIMG_09172
Accession: ref|XP_001239551.1| Score: 833 E_value: 4e-87
KEGG Definition: dual specificity phosphatase
Accession: aor:AO090120000287 Score: 772 E_value: 2e-80
KOG Definition:
Classification: [Defense mechanisms].
Kog Number: KOG1716 Score: 256 E_value: 7e-23
PFAM Definition: DSPc, Dual specificity phosphatase, catalytic domain. Ser/Thr and Tyr protein phosphatases. The enzyme's tertiary fold is highly similar to that of tyrosine-specific phosphatases, except for a "recognition" region..
Pfam Number: pfam00782 Score: 229 E_value: 9e-20
Swissprot: P38148|PPS1_YEAST
Gene Ontology:
GO:0005515 = Molecular function: protein binding
GO:0008330 = Molecular function: protein tyrosine/threonine phosphatase activity
GO:0006470 = Biological process: protein amino acid dephosphorylation
GO:0007090 = Biological process: regulation of S phase of mitotic cell cycle

Sequence:
>Contig4499
TTGGGGGGACAACTTTGTACAAAAAAGTTGGCCGAAACTTCACTACTGGC
TTTGGCGTATCTTATGTATTCTGAAGGATTACCCGCACATTCGGCCTGGA
TTCAGCTACACACCGTCAAAAATCGAAATTTCTTTGCGTACGAAAAGGAC
CTTCATTTCCTTCGCTTTGCTGAGCATCGGATTCTTGAGGCAGCTGCTGA
GGATAAGGGCTATTGTCTTAACTATGCTGTACTCAACCCCCCCGGATGGA
TCCACCGCATGGATGGGTCACTACCTAGCCGCATTTTATCCTACATGTAT
CTAGGGAACCTACAGCATGCTAACAACCATGGGCTACTCGCTGCGTTGGG
TATCAAGCGTGTCTTGAGTATCGGGGAGGAGCTATCTTGGACAGATAAAG
AGAAAAGCAAATGGGGTGCTGATAATGCGATGGTTGTTAAGGATTTGCAG
GATAATGGATGTGACCCACTAGAGTATCAGTTCAGGCGATGCCTGGACTT
CATTGAAGAAGGCCGCCATGCGGATGAACCAATCCTCGTACACTGCCGAG
TAGGGGTCTCTCGGTCAGCAACAATATGCATTGCTGAGGTCATGCGCGCC
CTCAAGCTCTCGCTCCCTCGAGCCTACTGTTATGTTCGTGCCCGTCGCTT
GAACGTTATCATTCAGCCCCATCTGCGTTTCATGTATGAGCTGCTTAAGT
TTGAAGAGAAGATCTCTTTTAAGAACCGTTGCACACCTAAGCGTGAGTTG
GAATGGACTCATATAGCACGAGAGATTGCAACAATGAATCGTCCTTACAC
ACGTCAAAACTGATAGTTCATGCGAGCTTGTTTGAGGTACCTTTTGTTTT
CTCGCACTTCTCTTTGGTTGTGATAAATATCCCATGAATTCCTTTTTTTA
TTTCCTTCTTTTAACCTTCCTTTCAAATTTGTCATATTTTTGTAGTCACA
ATAGCTGATATTTAGCTGCTATATTTTATTTATTTATTTTTTTTACTTTT
CTTTTGTGGGTGTTTTCTCTTCCTTTCCCTTCCTCTCTTGATTCTCCTAG
TTGGCTGTTTTGGGGAGTCTTTCCCGTTTTATTTTTTTCCCCGCATATCT
GGTTTCGTCTGTTGGGTACGGTTTGGTTCTCGGGTATG

Sequences in the Contig:

SY0AAC34YE07FM1 SY0AAC40YF07FM1 SY0AAD1YN20FM1