Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4498
Length(NT) : 823
Best Gene Model Blast : Link to GSTUMT00002513001 E-value : 1e-131
Numbers of ESTs : 8

Blast Results:

Nr Definition: DNA damage-inducible protein 1
Accession: sp|Q2H085|DDI1_CHAGB Score: 192 E_value: 5e-13
KEGG Definition: DNA damage inducible protein
Accession: aor:AO090005000469 Score: 179 E_value: 7e-12
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones, General function prediction only].
Kog Number: KOG0010 Score: 113 E_value: 2e-06
PFAM Definition: No Hit Found
Swissprot: Q2H085|DDI1_CHAGB

Sequence:
>Contig4498
TTGGCATCTGTTGCATTCCAGCCTGCTTGTACCGCGGACGGGTAAAACTC
GAGTGTGTGGTATCTCACCCTCGCTCTTTGCCTCCCGCCTACACCCCTCC
TTTTCCTTCCCCATCTTCCCTCCTCACGCCCGATCCCCACTCTTTTCCTT
CGAGTGCCATCCCTTCCCTCTCGGTCCTGATACTTCCAAGTGCTTCCATT
CCATCAGCATTCACCTTTGCTTCTCTGCGTATCGAGTTGCCACCCCCACC
CCCCACTACGACAAACTTGAGAGCACAATTGTCTCCTTTGCTGATACGCT
GAATTCCAAATCAACCCTTCAAAATGCGTCTCACCGTATCGTTCATCTCA
ACCTCTCAAATCATACAGCTCGATGTTCCATCCGATATGTCAACTGTGGA
TTTTAAGGCGCTGATTGCTGCAGAGATCCCCGCTGTCTCTTCCGTGGCCC
AGCATCTCTATCACAATGGTCGGCTCCTCGCTGACTCTGCCAAAACTCTT
GGAGAATACGGGGTTGCCGAGGGGGATATGATAGTCTTGCATACGCGGGG
TAGTAGCAGCAGCAGCGGTTCTCCCGGAGCCGCATCTGGTCAACAGCAGC
AACAGGCTGGGGCAATAAGGCGTTCATCAGGAGGCCCTTCCCAAGGCGCG
GGTAGAGGTGCTCCATACGGGCGGCGACCCGCAGCAGCGGGCCCGCCATC
TGCTCCGGGAGGCCAATCCGGCATGGACTCCGAGATGATTCGTTTGCAGG
TTCTAGGGGACCCGAGGTTGATGAATGAGCTCAGGAACTCCCAGCCGGAG
CTGGCCGCGGCAGCCAATGACCC

Sequences in the Contig:

SY0AAA29YE07FM1 SY0AAA4YC04FM1 SY0AAB32YN09FM1
SY0AAB3YH18FM1 SY0AAC34YE04FM1 SY0AAC36YM05FM1
SY0AAC37YE14FM1 SY0AAD56YB03FM1