Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4496
Length(NT) : 656
Best Gene Model Blast : Link to GSTUMT00002136001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: electron transfer flavoprotein alpha-subunit, mitochondrial precursor
Accession: ref|XP_962674.2| Score: 362 E_value: 1e-50
KEGG Definition: hypothetical protein
Accession: ang:An07g02700 Score: 352 E_value: 4e-48
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG3954 Score: 360 E_value: 3e-35
PFAM Definition: ETF, Electron transfer flavoprotein domain. This family includes the homologous domain shared between the alpha and beta subunits of the electron transfer flavoprotein..
Pfam Number: pfam01012 Score: 200 E_value: 1e-16
Swissprot: P13803|ETFA_RAT
Gene Ontology:
GO:0005759 = Cellular component: mitochondrial matrix

Sequence:
>Contig4496
TTGGCAAACTTTCAGCCATGTCTATTTGTGTCGCCCAGACAAGAGCTTCC
CTGCTTCGATTACCTCATCAGTCCGCTCGTTCTACCGTCCGCTCTCGTCC
ATTCACGCCCAGCCCACGACTTCTCAACACTCTTGCAGTTCTCGAACACA
AAGATGGAAAGGTTTCTTCTCAATCATTCCCGGTCGTCACCGCTGCTTCA
AGATTTGGTGGGCCTGTCACTGTTTTTCTCGCAGGCTCAGGTTCGAAGGA
AGTATCAGAACAAGCTGCGAAACTCAATGGCGTCGAGAAGGTAATTTACG
CTTCAAACAGCGCCTACGACAAGAGAACATTAAGAGGGGACACTTTACAC
ATGTCGTCGGTTCCCACTCGGCATTTGGTAAAAACATTTTGCCACGGGCA
TCTGCTCTGCTGGACATTCAACAGATTTCCGACTGTATTGAGATCAAGGA
CGAAAATACCTTTGTCCGACCCATCTATGCCGGTAATGCCATAGCAACAG
TCAGGTCTACCGACACAATCAAGATTGTCACTATCCGAGGAACTGCGTTC
CCCCCAGCGGAAGAGACATCAGATACAGCGACTATCGAGGAGGCGCCTAT
AGATCCTAATGCAGAATGTACAACGGTTTGGGTGTCCGAGAACCTCACTA
GATCAG

Sequences in the Contig:

SY0AAC34YD20FM1 SY0AAC45YG15FM1