Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4495
Length(NT) : 714
Best Gene Model Blast : Link to GSTUMT00002997001 E-value : 1e-13
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4495
TTGGCGGATCGCGAAGCTCTAAAGTCTAGATACGCCATCTGAAAAGCATA
TTGGCACAGTTTGAAACTATAGAGTTTCATTGCTTGAAGCTCTCGTCTCA
TTGTGTTTCATCGCTTTTATCTTGTTGAAAACGAATGGGAAGGTGAAAGA
TAATAGTTGCAATTATTTTCTGATCTTACGACTATTAGTTGCTCTTCTTG
TCATGTTCCTCTCTTGATCATTCGCTTAGCTAGTTTTTCTTGTTATACAA
TAGAACGGCCGTGACAAGAGGTGGAATAGTTTTCAAATCAAAGAAAAAAA
GCTATTTTTTTCGTTTTTTTCGGGTGTTTCTCATGGTTTCGAAATGGACG
GCGCGTTTTACAGATTTTCATTTATTCTTTCAAAAGAAACTTCTGGGGTA
TTTCTCTTTCCTGCATGAAGCAAAAAAAGGATTAAGCATCTGATGGCAAA
TATGGTACAGTACGGAGTACGTTGTTTCGATGATTTTTTTCCCATTTCTC
CGCGTTTATCTCTCTTTTTTTTTTTACCCCTTCCTTTCCGCAAAGTATTT
CTTTATTGCATCTGCTCTGACACCTTGTTATGAAATCGTTGGGTGTGCAG
AAGGATAAGTTAAGTGTAGGATGCCATATCTCTGGATTGAAAGCTTTACA
AGGATTTAGAAGCATTTACCCTACCATAGTAGGACTGACGGATATTATAC
AGTACCTATTCCCT

Sequences in the Contig:

SY0AAA21YC21RM1 SY0AAC34YD06FM1