Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4494
Length(NT) : 1278
Best Gene Model Blast : Link to GSTUMT00011059001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: geranylgeranyl pyrophosphate synthetase
Accession: ref|XP_960695.2| Score: 439 E_value: 1e-93
KEGG Definition: GERANYLGERANYL PYROPHOSPHATE SYNTHETASE (GGPP SYNTHETASE) (GGPPSASE) (GERANYLGERANYL DIPHOSPHATE SYNTHASE) [INCLUDES: DIMETHYLALLYLTRANSFERASE ; GERANYLTRANSTRANSFERASE ; FARNESYLTRANSTRANSFERASE ]
Accession: ncr:NCU01427.1 Score: 439 E_value: 7e-94
KOG Definition:
Classification: [Coenzyme transport and metabolism].
Kog Number: KOG0777 Score: 452 E_value: 1e-45
PFAM Definition: polyprenyl_synt, Polyprenyl synthetase..
Pfam Number: pfam00348 Score: 220 E_value: 1e-18
Swissprot: P24322|GGPPS_NEUCR
Gene Ontology:
GO:0005625 = Cellular component: soluble fraction
GO:0004311 = Molecular function: farnesyltranstransferase activity
GO:0006720 = Biological process: isoprenoid metabolic process

Sequence:
>Contig4494
TTGGCAGCCTCTTCTCCATCATCATAAATCCTATTTCCCTTGTCAATAAA
TCCCTATTTCTAATGACCCCAGAGCCTTCCACCACCAGCCGGCATCGTCA
CTCGCCCACATTAAAACCTCTTAAACCACGGGTCGATTCGGACGCTCCAG
TTCAGAATGGAACACCCCAGACTCGGAGCGCTGATGTTTTGGTAGCCGCT
GGATTTCAACGTCAATGGTCCGAGGAGAAAGAAAATATATTACTTGGGCC
TTACAACTATCTTGTCTCCCATCCAGGAAAAGATATCCGCCAGCAATCCA
TAACGGCCTTCAACAGCTGGCTGCAGGTTCCTGAAGTCTCTCTTCAGATA
ATTACCAAAGTCGTAGCTATGCTACATAATGCCTCACTTTTGTAAGAGCT
TCTGAATTTGAACTGGTCCTTAACCTATTTTAACGAAACTTGATAGGGTC
GACGATGTTGAAGACCGTTCTAATTTGCGACGAGGTTTCCCTGTAGCGCA
CAGTATATTTGGGGTAGCACAAACCATAAACTCCGCGAACTATGTGTACT
TCCAGGCCTTACAGGAACTTTTGAAACTCAACAATCCATTAGTGCTCAGG
ATTTACACAGGTTAGCTAGCAAAGTCCCACGGCGTCCGCTTGATGCTAAC
CTGATGCGCTTGTTTGTCTAGAGGAACTACTGAATCTTCATCGGGGCCAG
GGGATGGACCTCTTCTGGAGAGATACATTGACAACACCGACCGAGGATGA
CTATCTGGAGATGGTTAGCAATAGTTAGTAGATCCTTTACCCCCGTTCTT
GTGTTTAGTCCATGACATGATACTAGCTCACATTCTGTAATAGAAACTGG
TGGGTTATTCCGTCTGGCTGTGAAGCTCATGCAAGCCGAGAGCGCCTCGG
ACAAAGATTATGTTCCCTTGGTCAATATTATTGGTCTGCTTTTCCAAATC
CTCGATGATTACTTAAATCTCCAATCAAATCAGTACACCAAGAATAAGGG
ATTCTGTGAGGATCTTACCGAGGGAAAATTTTCATTCCCTATAATCCACG
CCATCCGCAGTGATCCATCCAACCGTCAACTGTTAAATATTTTGGGGCAG
CGAACTACAGATGAGGATGTCAAAATGTACGCCGTTGCCTACATGAAAGA
CCAAACAGGCACCTTTGACTACACGAGGAAAGTTATCCACGATTTACACA
AGAAGGCATTGGAGGCGGTTGAGGAACATGGTGGAAACCCGTTACTGGTC
GCGATATTGATGAAATTGGTGGCTAGAT

Sequences in the Contig:

SY0AAC34YD04FM1 SY0AAC39YN09FM1 SY0AAD36YB10FM1