Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4493
Length(NT) : 850
Best Gene Model Blast : Link to GSTUMT00002346001 E-value : 0.0
Numbers of ESTs : 13

Blast Results:

Nr Definition: eukaryotic translation initiation factor 2 alpha subunit
Accession: ref|XP_961905.1| Score: 755 E_value: 3e-78
KEGG Definition: hypothetical protein
Accession: ncr:NCU08277.1 Score: 755 E_value: 1e-78
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG2916 Score: 866 E_value: 9e-94
PFAM Definition: EIF_2_alpha, Eukaryotic translation initiation factor 2 alpha subunit. These proteins share a region of similarity that falls towards the C terminus from pfam00575..
Pfam Number: pfam07541 Score: 268 E_value: 2e-24
Swissprot: P20459|IF2A_YEAST
Gene Ontology:
GO:0005850 = Cellular component: eukaryotic translation initiation factor 2 complex
GO:0043614 = Cellular component: multi-eIF complex
GO:0005840 = Cellular component: ribosome
GO:0003743 = Molecular function: translation initiation factor activity
GO:0006413 = Biological process: translational initiation

Sequence:
>Contig4493
CTATTCCAGCCAACGGCGACTACGACTCCCATCACCTCCACCACTTCATC
ACACACAACCCTCGTGGCAGCTGCATCTCACTCCTTTCACACACGCACAA
AATAAAAACCACGTTCGGAAAGAAAAGGAAAGAAAAAATCTGGTCTCACA
TTTCGCTATCGCTGAATAACAATTTACAATTTGCCTTTTTTTTCTTCTTC
TTCCTCCCTCCCTCGCCTTGATATCAAACTAGGTCGCAGCAATCATGTCA
CTCCCTACTTGTCGGTTTTACGAGGAGAAATATCCGGAGCTTGATAGCTA
TGTTATGGTCAATGTTAAGCAGATCGCAGAAATGGGAGCATATGTGAAGC
TTCTGGAATACGACAACATCGACGGCATGATCTTGCTTAGTGAGCTTTCC
AGACGGCGTATCAGATCTATCCAAAAACTCATTAGAGTTGGAAGAAATGA
GGTTGTGGTTGTCTTGAGGGTCGATGAAGAAAAAGGATACATTGATCTTT
CCAAGCGTCGTGTATCTGCCGAGGACGTTGTCAAGTGCGAAGAGAGGTAC
AACAAGAGCAAGATGGTACACTCCATTCTCCGGCATGTCGCCGAGAAAAC
AAAGGAGCCTATCGAAAACCTCTACGAAAATATTGGTTGGCCCTTGATGA
AGAAGTACGGCCACGCTGTCGACGCATTCAAATTCTCGATTACCAATCCG
GACGTATGGGAAGGCATCCAGTTCCCCTCAGAAGTTGTCAAGACTGAACT
CCAAACCTACATCTCCAAGCGCCTAACCCCCCAACCAACCAAAGTCCGCG
CAGATGTCGAAGTCACCTGCTTTGGATACGAGGGTATCGATGCCGTTAAA

Sequences in the Contig:

SY0AAA21YM06FM1 SY0AAA53YM23FM1 SY0AAA5YF01FM1
SY0AAC24YD06FM1 SY0AAC2YJ08FM1 SY0AAC30YK14FM1
SY0AAC34YC23FM1 SY0AAC37YF07FM1 SY0AAC39YM13FM1
SY0AAC51YL13FM1 SY0AAD12YE17FM1 SY0AAD48YO16FM1
SY0AAD55YA22FM1