Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4492
Length(NT) : 4172
Best Gene Model Blast : Link to GSTUMT00006745001 E-value : 0.0
Numbers of ESTs : 87

Blast Results:

Nr Definition: NAD+ dependent glutamate dehydrogenase, putative
Accession: ref|XP_001260222.1| Score: 3945 E_value: 0.0
KEGG Definition: hypothetical protein
Accession: ang:An02g14590 Score: 3936 E_value: 0.0
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG2250 Score: 839 E_value: 6e-90
PFAM Definition: ELFV_dehydrog, Glutamate/Leucine/Phenylalanine/Valine dehydrogenase..
Pfam Number: pfam00208 Score: 357 E_value: 6e-34
Swissprot: P00365|DHE2_NEUCR
Gene Ontology:
GO:0004352 = Molecular function: glutamate dehydrogenase activity

Sequence:
>Contig4492
TTGGCGAGGTTATTCCGCTATCATTGTCTACTATACATATCTACAGGGAA
GCTCGGATGTGAGTGAGTGAGTGAATAAAAAACAAAAAAAGGCTACAGCA
AAAACTAACGACGACAAGGGCTAAGGGTACCGGTACTTCAACAACATCTG
CGAAAAAGTCCGAACAGGGATGAGCTCATGAAGCTGGCTTTCCCAAGCAT
GTACTGTACCCTCACATTGCTTAGCAAGCTACCGTATATAAGTTGAAGCT
TCCCACACTTGTCACGAACCTTTGAACAGCAAACAAAAAAAAGGGTACTA
TACTCACCTCGCTCCTCCGCCGGACAAGAGGATAAGAGAACCTGCCGTCT
CTCCCTACCCCGATAGTCTCAGCGCCTCTCTTTCCACCCCCCCTCTCATC
TTTGCCCATTTGTCTCGTTCTCTACTTTTACATTTTTCCGCCTTCCGTCT
GCCGTTTTCGTTTTCCACCACGAACCGACCCCTCCTCCACCGCCACCTTC
TCATCCAGACTCTATTGTTCCTACTTCTCGACCGATAACCCGTTGCGAGC
ACGCTCCTATCTTCCAGAAACTACTTGTTTATTTCACGGTTCATCATCAT
GGCTCCTAGTTCTACGCTTGCCGCTCACGCCGGCATCAATCGGTTCAACA
CTCCTAGTCCGCATCCGACACACCTCAGTATTGGCGTTCATAATCAACGG
GTTTTGAAAGATGATGCCTCCGGTTATGTTGCACCCGTGTTCGAAGGCAA
GGAGAAGCAGATGGAGCATGTCATGGACATGCTCGAGGAGAAAGGATTCA
TCCCTCCGGATTTCGTTGAGAGTGAGACAAAGTGGTTTTATTCATCGCTC
GGGATCGACGATATGTACTTCAAATCAGAAACTGCTGAAACAATTGTGAA
CCACATTTTGTCTCTCTATGCCGGCAAGGTTGCGGCATTTTCTCGGGATG
ATAAGCGTTTGGAAATTCGGCTGGACAGAGAAGCAGAGGATCATGCTGTA
TACATTGATACATCTACCCCTGGAGTATCCGTGCTCTCCGGCCCGCAGTA
TGAGCAGAGAATCGACAAGAAATACCTCAACCCTTCGAACCCTGCGAAAG
CTTACCGCGTTGAAACCTTCCGCTCCTCTTCCCAGCTTACGGCGTCGCAC
CAGCAGCTCCGCTGCTACTTCGTCTACCAATGCGATTTTGTCAATCCAAA
CCCTGATCCTAATGAGACGGACTTGAGCGTTATCTCGGATAAATCCTTTC
TGGAAAAGGTTACTCCTAACACCAAGGAGGTCTACCAGGGCATTGTCGGG
TCTGTTATTGAGCGGACAGGCCCCGTTATCGAGATGTTTGAGGTCCAAGG
TACACGGGAGAAGAGGCTCGTCATCGGGTTTAAACAAGGGAGCTCCATGG
GCTTGTTTTCGGCTTTGAGTGACCTTTACCACTACTATGGGTGTACCTCT
ACGAGAAAATATGTCGAACAATTCTCTAACGGTGTGACTGTAATGTCAAT
CTACCTTCGACCTCTCCCCTATCATACTACCATCCCGAACCCTGCAATGT
TCCCGCCTATCGAGGCATCAATTTACCAAATCATGAAGGAAGTTTCTCTT
CTATACTGCATACCCCAAAATATCTTCCAGGAACACTTTATTAGTGGCCG
TTTGAGTCTGCAGGAGACAATATACGCTCATTGTGTTTGCCACTTCGTGA
GCCATTTTCTGAATAGGCTAGGTTCGGAATATGGCGCCCTATCCTCGTTG
CTCGACGCGAGCAATAGTGTCCACGCGGAGACTCTCACCAAGATCAAGCG
TCGCCTTCGTCAAGAGACCTTTACTTCGGATTATATCTTCGAGATCATTA
ATGACCACCCTGAGTTGGTTCGTTCATTATACCTGTCGTTCGCTAACCAG
CACTATGTGCAAACTCGGGGCGAACACGATGACTTTATCCCTACGCTTAG
TTATCAGCGTTTGCAAGTTGGCCGGGTGTTGAAGGATGATGAACTAGAGA
CTTTGATATCGACGAGCGTCGGGAATGAGCATCAAGAGAAAGTCATGCAG
TACTTTATTACCTTCAACCGCAACGTACTGAAGACCAACTTTTATACTCC
CACAAAGGTTGCGCTGAGTTTCCGACTCAACCCCCGATTCTTACCCACTG
TTGAGTATCCTCAACCATTGTTTGGCATGTTTTTGGTTATTGGATCAGAG
TTTAGGGGATTCCATCTGAGGTTCCGGGATATCGCCCGTGGAGGTATCCG
TATCGTCAAGAGTAGGAACCGGGAAGCATATGCGATCAATGCGCGTTCAG
TCTTCGATGAGAATTACAACCTCGCAAACACTCAACAACGCAAGAACAAA
GATATCCCGGAAGGTGGTAGCAAAGGCGTCATTCTCCTTGATGCCAACCA
TCAAGACAAGGCTACAGGAGCATTCCAGAAATATATTGATTCGATTCTAG
ATCTTCTCCTTACACCCAATAGCCCAGGTATCAAGGATCCTATTGTTGAT
CTTCACAAGGAGCCTGAGATTTTGTTTATGGGTCCTGATGAGAACACTGC
CGGCCTAGTGGATTGGGCTACTGAGCACGCTAGAGCGAGAGGCGCCCCTT
GGTGGAAGTCCTTCTTTACCGGAAAGAGCCCTAGCTTGGGTGGTATTCCT
CACGATACTTATGGAATGACATCCTTGAGCGTTCGCGAATATGTTCTTGG
CATCTACCGCAAGTTGAATGTTGACCCGTCCCGGATGAGGAAATTGCAGA
CTGGTGGACCCGATGGTGACTTGGGATCAAACGAGATCCTTCTGAGTAAC
GAGAAGTATGGTGCTATTGTTGATGGGTCTGGTGTTCTGGTCGACCTGAA
TGGTCTTGATCACCAGGAACTCATTCGCCTGGCCAAGAAACGTCTTATGA
TTTCCGAGTTTGATATGTCCAAGCTCTCACCTGAGGGGTATAGAGTTCTT
ATTGAGGATACCAACGTCACTCTTCCTAGTGGCGAGGTTGTCACCAATGG
TACTATTTTCCGTAACACCTTCCATACCCGCACCCATATCCCATACGATA
TTTTCGTTCCTTGTGGTGGGCGACCCGAGGCAATTGACTTGGGCAATGTT
GGCAAATTCATCAAGGACGGAAAGAGTGTTATTCCTTATATCGTTGAGGG
CGCCAACTTGTTCATTTCTCAGGACGCTAAGCTGAGATTAGAGGGTGCTG
GTACAATCTTGTTCAAGGACGCTAGCGCCAACAAAGGTGGTGTCACTAGT
TCTTCCATGGAAGTCCTCGCATCACTTGCCTTTGACGAGGCCGGGTTTGT
CGAGCACATGTGTGTCCAAGACGGCGTCGTTCCCAAGTTCTATAAGGTGT
ACGTTCAGGAGGTTCAGAAAACCATCCGGGATAATGCCCGCCTAGAATTT
GAGGCCATCTGGCGCGAGAACCAGCAAACCGGAAAGAGCCGTTCCATCCT
TTCTGATGAGCTCTCCCTAGCGATCACCAGGTTGGATGAAGAGCTCCAGA
AGACCGAGCTTTGGAATAACGTTGTCTTGAGAAAGGGCGTTCTCGAAGAT
GCCCTCCCGCAAACCCTCCTACAGCAGATCGGTCTCGACCTCATTCTTAA
GCGTGTTCCTGACAACTACCTCCGCGCTATCTTCGGTAGTTACATCGCTT
CTCGCTTTATTTACGAGTTTGGCAGCAACCCGAGCCAATTTGCTTTCTTT
GATTTTATGACAAAGAAGATGGGTGCGCTTGAGGCTAAGGCTACTGATAA
GCCTTCCCAGGTCCTCACTATCAACTCCTTCCCCACCAAGAATTGTACTC
ACTGAGCGAGGAAATGTTTATCCCCTTTCAAAAAAAAAGAAACTAAAAAC
TAAAAACTAAAAACTAAAAACTAGAAATCCCTTTTCGTGCTCTTCCTCAT
CCCTCTCGGGGGTTTTTTTTTTCCAACTCTTCTCCTGTTTTTTCTTTCTT
GGTTAACTTTTTGAATGGCATGAGTTTGATAAAGGGGATACGGTTGCTGA
GTGTCGGTGTCTCATGCCACGGGCATGGTGGGTGATGTACGTTAGGTTGC
TCGGTTAGTTTTTGGTTTTTGTAACATAGAACAAGAGCTTTTTTAGCTTT
GTTATGGCGGCCGGGGCTTCGCTCCGATGAGGGAAGGAATTTCATGGGTT
ATTTAGTCGATTATGACACCAG

Sequences in the Contig:

SY0AAA28YJ11FM1 SY0AAA30YN17FM1 SY0AAB19YD13FM1
SY0AAB22YP09FM1 SY0AAB28YC20FM1 SY0AAB44YD03FM1
SY0AAB60YL05FM1 SY0AAC11YA13FM1 SY0AAC15YH15FM1
SY0AAC17YL15FM1 SY0AAC18YE01FM1 SY0AAC1YH12FM1
SY0AAC20YE15FM1 SY0AAC20YI17FM1 SY0AAC20YI17RM1
SY0AAC20YN16RM1 SY0AAC21YH04RM1 SY0AAC21YJ15FM1
SY0AAC21YJ15RM1 SY0AAC22YB09FM1 SY0AAC23YE13FM1
SY0AAC23YP22FM1 SY0AAC25YA02FM1 SY0AAC29YE24FM1
SY0AAC2YC04FM1 SY0AAC31YJ16FM1 SY0AAC31YJ16RM1
SY0AAC32YO24FM1 SY0AAC33YJ04FM1 SY0AAC33YM05FM1
SY0AAC34YC19FM1 SY0AAC36YH03FM1 SY0AAC39YO18FM1
SY0AAC40YD02FM1 SY0AAC40YF16FM1 SY0AAC43YB02FM1
SY0AAC45YL08FM1 SY0AAC47YA07FM1 SY0AAC47YH09FM1
SY0AAC47YP22FM1 SY0AAC49YJ02FM1 SY0AAC4YG24FM1
SY0AAC50YO06FM1 SY0AAC55YH22FM2 SY0AAC56YI14FM1
SY0AAC56YP17FM1 SY0AAC5YC09FM1 SY0AAC5YE22FM1
SY0AAC5YO01FM1 SY0AAC62YG07FM1 SY0AAC6YL23FM1
SY0AAC8YF14FM1 SY0AAC8YM01FM1 SY0AAD13YP12FM1
SY0AAD14YD20FM1 SY0AAD14YP05FM1 SY0AAD15YP04FM1
SY0AAD16YF12FM1 SY0AAD16YN19FM1 SY0AAD17YE23FM1
SY0AAD19YH16FM1 SY0AAD24YK03FM1 SY0AAD25YA04FM1
SY0AAD27YK21FM1 SY0AAD28YE18FM1 SY0AAD29YD13FM1
SY0AAD2YN08FM1 SY0AAD30YE04FM1 SY0AAD32YI09FM1
SY0AAD35YA09FM1 SY0AAD35YI17FM1 SY0AAD38YN04FM1
SY0AAD41YA06FM1 SY0AAD43YP04FM1 SY0AAD45YM05FM1
SY0AAD45YN10FM1 SY0AAD46YI08FM1 SY0AAD48YC24FM1
SY0AAD50YP22FM1 SY0AAD53YB08FM1 SY0AAD56YM21FM1
SY0AAD62YO10FM1 SY0AAD63YA14FM1 SY0AAD63YC12FM1
SY0AAD63YF01FM1 SY0AAD7YI04FM1 SY0AAD8YG20FM1