Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4491
Length(NT) : 1394
Best Gene Model Blast : Link to GSTUMT00002792001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: ubiquitin fusion degradation protein (Ufd1), putative
Accession: ref|XP_001274751.1| Score: 866 E_value: 7e-91
KEGG Definition: ubiquitin fusion degradation protein (Ufd1), putative
Accession: afm:AFUA_4G04640 Score: 843 E_value: 2e-88
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1816 Score: 244 E_value: 2e-21
PFAM Definition: UFD1, Ubiquitin fusion degradation protein UFD1. Post-translational ubiquitin-protein conjugates are recognised for degradation by the ubiquitin fusion degradation (UFD) pathway. Several proteins involved in this pathway have been identified. This family includes UFD1, a 40kD protein that is essential for vegetative cell viability. The human UFD1 gene is expressed at high levels during embryogenesis, especially in the eyes and in the inner ear primordia and is thought to be important in the determination of ectoderm-derived structures, including neural crest cells. In addition, this gene is deleted in the CATCH-22 (cardiac defects, abnormal facies, thymic hypoplasia, cleft palate and hypocalcaemia with deletions on chromosome 22) syndrome. This clinical syndrome is associated with a variety of developmental defects, all characterised by microdeletions on 22q11.2. Two such developmental defects are the DiGeorge syndrome OMIM:188400, and the velo-cardio- facial syndrome OMIM:145410. Several of the abnormalities associated with these conditions are thought to be due to defective neural crest cell differentiation..
Pfam Number: pfam03152 Score: 250 E_value: 5e-22
Swissprot: P53044|UFD1_YEAST
Gene Ontology:
GO:0034098 = Cellular component: Cdc48p-Npl4p-Ufd1p AAA ATPase complex
GO:0005515 = Molecular function: protein binding
GO:0006397 = Biological process: mRNA processing
GO:0015031 = Biological process: protein transport
GO:0006511 = Biological process: ubiquitin-dependent protein catabolic process

Sequence:
>Contig4491
TTGGCGACACTTCAACTTCGACAACCGCTCCATTACCTACATCTTCATCA
GAGAGGAATGAAAATTGCCCTGCACCTCTGTTATGGCTTCCCCAGTGCTA
CATTGGTCCAGCCAGTTATCCGTACTGCCCTCTTCGGAGATATCATCTTC
TCTTGTCGGTGATAAAATACTTCTACCGCAATCAGCGCTTGAGCAACTCC
TTGCCGCCGTTTCATCAACGCAGTCGGGGTCGCAGCCAACACCAGCTTTG
ACAGACACTCACCCGCCGCAGGTAGATATTTCATGGGCTTCTGCAGCTCG
CCATGAGCGCCCGCAACCACAGCTCCCGCACCCTCTCATGTTCAGACTAT
TCAACCCAAGAAATAACCGATTCTCACACGCAGCCCCTTTAGAGTTCTCC
GCAGAGGAAGGGAAGATTGGTATATCACCGTTATTACGGGATGCACTGGG
TATCGATGAGGATGTAGAGATGAAAGGTGCGGGGGAGGGGGAACTGGTGG
AGGATGAGGAAAAGAGAATTACAGTCGTGTGGAAAGATTTACCGAGAGGC
ACTTATGTGCGATTAAGACCTTTGGAAGCGGGGTATGATGAGGAGGATTG
GAAAGCTTTGCTAGAGAGATACTTGAGGGTCAACTTTACTACATTAACGG
TTGGCGAGATTTTGGCGATTGGGGGGAGAACACTGGCGATTGGCGGGAAG
GAAAAGGCAGAATTTCGGTTTTTGATTGACGCCATGAAACCGGAGGAGGC
GGTGTGTATTGTCGATACTGATCTAGAAGTTGACATTGAACCATTATCCG
AAGAGCAAGCTAGAGAAACCTTGAAGCAACGGCTAGCACGGAAGTCCGTC
GGTAGCAGCGGTGGCGCTCTCAAGATCGGCCAGCCAGCCAAAGGTGGAGT
TCTGCCGGGTGAATATCACTTCTACGAGCTATCGGAATGGGACCGAAAGG
AGCCGCTCGTAATAGAACTCGACGAAGTAGACGACGGTGACGAAGTGGAT
ATATTTGTTACAACATCCAAACACCATCACAAGCCTCGACAAGACGAGCA
TGCATGGGGAGATTCCGGAAGTAAATATCCAAAAACAATACAAATCAATC
CGACAAACATCGAGCTTGTTGACGTGGAAAGGATATTCATTGGCGTCCAC
GGATATGCGCCACTAGACATAGAGGAGGGCGGTGAACAACAGGCTGAGGA
GGATAACTCTCCCCGCCCATATTCCCTTCGAATCACCCAAACCGAAATCC
AAGACACGGAAGCCCCCACCATCACTACTCCACCAAGCCCCGACTACAAA
CAATGCAGAAACTGCACCCAGTGGGTCCCAACTCGCACGTTCATTCTTCA
CGAAAACTTCTGCCTGCGGAATAACCTTGTGTGCCCCCATTGCC

Sequences in the Contig:

SY0AAA19YE14FM1 SY0AAA33YG18FM1 SY0AAB33YO14FM1
SY0AAB46YH22FM1 SY0AAB49YF04FM1 SY0AAC34YC10FM1
SY0AAD17YN06FM1 SY0AAD43YP24FM1 SY0AAD61YF20FM1