Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig449
Length(NT) : 681
Best Gene Model Blast : Link to GSTUMT00010057001 E-value : 2e-83
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig449
TTGGCTTTAGGCTCACTCACAGCCCCTCACTCGCAATCTTGTGCCGCTGA
TAACAGCAGCGGCAATAGAGACCGGAACCGCACCCGCACCCGCATCAACC
GGGGAAGGGACAGGGGGAGATATTTGCTGCTGGGCAGTTATATGTTCCCC
TGCGCTTAGAGGGCTGCTAGGACCAGTGGAGTTATCGCCGCGGCGACAGT
GAGTGCGATGACCGGAAACGGTATGTCTAATCCATTCAATAGAGTGACAC
CGACGTGTTTTCTTGCACTACAGGAGATTGAACCCTACTAGCAGAGAGTA
GACCAGACATTCGCGGAAGTGAACCATGCGTTGACCTCCTTCTGGACACC
CAAGTCTTCGGAACGCAGACCTGCACCACCCTCCCGTCCGTGATGCTCGA
CGGCTGGGGGCTGCAATTCAACCGGTGTGTGCGGTTTCTTCGGGGGACCC
TCGATGAAAGCTACCTCCACGGCTTCATCCTCATCCACTTCTCTTGCATC
ACGAAGTTCGTGGTAAAAGTTCCTGGACTACTACTGCAGCTGCCGTGCAA
CCTCCATCCGTATCATCGCACACATCGACAGCACCACGCTGAGCGATGGG
GCATACCCCAGCGGCGGCGCACCACATATCGGCCGGATATCCTTCCACTA
GGAGGTCATCTTCGGGGTTGAGGCTGGGCGA

Sequences in the Contig:

SY0AAA24YE11FM1 SY0AAA24YE11FM2