Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4489
Length(NT) : 744
Best Gene Model Blast : Link to GSTUMT00001860001 E-value : 1e-126
Numbers of ESTs : 13

Blast Results:

Nr Definition: hypothetical protein NCU06977
Accession: ref|XP_962617.1| Score: 278 E_value: 7e-31
KEGG Definition: hypothetical protein
Accession: ncr:NCU06977.1 Score: 278 E_value: 3e-31
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4489
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCGATCGTCGTCCTTTATCTC
TCATTCAATAGGTAGCGCTATCAGTTCTCTTGGAAGGCCTGTGGTTCAAA
CGAATCTTTGAGAATTCCTTGTAAAACTGACCCATAACAACTGCTAGGAA
CCTGCACACATCGAGCTATCTTGAGCTAAGTTAGACGAAATGGCTTTCTC
CAACCCGTTCTCTCGTGACATCGAGGGCACTAGCCGGAACATTCCTGCCT
ACCGTGCCTTCACTATCATCTCGTGGCTCCTCTTCTTTGTGGTAGCTATC
GTTTATAGCATCTCTCCTCCGCACGATGGTCATTGGGCCACTGGGACCAT
CTTCGTAAGTATTTGTATCCCTTTCCCGCTTTTTGGAGTTATATCCAGTC
GGTGAAAAATCCAATGCCTTTTAGGGTATAAGCAAAGCACATATCACACC
TTTCACACTCAGCCATGCATTCGTTGCCATTTACTGGGTCTTCCTGTTCT
GCAGCCAGATCAGCTTCGTTGCACAATTGTTTAGGAGGGATGAGGCCGCT
GTAACAGCTGCTGCTTCTGTTGGAAGCCATTTCATTCTTTTTAACCTTTT
GCAATTTGGTTGGATTATGCTCTGGACTCGCTCTCTATTCTTCTGGAGTG
AGTTGTTCGCCGCTTTAAACTTTTTGCAGCTGGTCTTGTTATACCTTCGC
AACCCTACCACACCAAGACTCGTTCACGTTCCGGCTGCCGCCAT

Sequences in the Contig:

SY0AAA57YI23FM1 SY0AAC16YI16FM1 SY0AAC27YI07FM1
SY0AAC34YB18FM1 SY0AAC55YM17FM3 SY0AAC57YM20FM1
SY0AAD28YF01FM1 SY0AAD36YJ09FM1 SY0AAD41YB08FM1
SY0AAD48YI08FM1 SY0AAD48YO19FM1 SY0AAD49YL05FM1
SY0AAD50YC13FM1