Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4488
Length(NT) : 737
Best Gene Model Blast : Link to GSTUMT00002552001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: casein kinase I isoform delta
Accession: ref|XP_965825.2| Score: 567 E_value: 1e-56
KEGG Definition: conserved hypothetical protein
Accession: fgr:FG08731.1 Score: 567 E_value: 6e-57
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG1163 Score: 441 E_value: 1e-44
PFAM Definition: Pkinase, Protein kinase domain..
Pfam Number: pfam00069 Score: 152 E_value: 4e-11
Swissprot: P40235|HHP1_SCHPO
Gene Ontology:
GO:0000935 = Cellular component: barrier septum
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0006281 = Biological process: DNA repair
GO:0045143 = Biological process: homologous chromosome segregation

Sequence:
>Contig4488
TTGGCACCTGACTTGGAGAAGAAACCCCACTTACTTGCTGCTTGCTCGCT
CGCCCTTCTCCTTTCACTTTTACTTTCCTCTCTCTACTATTTTTCCACTC
CCACGCCACAACTTAATCTTCTCTTTACCGTGAAACAAGCATCAGTTTTG
TCGTCGTAACCGCGTCATCCGGTTTTCTAAAGTCCTGTTTCTCTGTCGGT
CGGGTGTCTTTCTCCTCTAATTACCTTCTCCACCGACAATCAATCTTCCA
CCCTCTCAACCACGACAAGTCTCTCTTCCTCTTCGACCTCTACCACCTCA
AGCACCATCAACAACACGAGGCTGCCATCAGCTTTTTTAACTCTAGACCT
CACCAACACACCACGATTACAAGATTGTGTAGAGATTACAACGGAAACAG
TAGTTCGAGATGACGACCATGGATTTAAGGGTCGGGAATAAATATCGCAT
CGGTCGCAAGATTGGTAGCGGGAGCTTTGGGGATATTTACTTGGGCACCA
ATATTATTTCCGGTGAGGAGATCGCCATCAAGCTTGAGTCGGTCAAGGCG
AAACACCCCCAGTTGGAATACGAGGCCAGAGTTTACAAGTCCTTGGCTGG
AGGTGTCGGTATCCCGTTTGTTCGTTGGTTTGGGACTGAATGCGACTACA
ATGCTATGGTTCTCGACCTGCTCGGGCCTAGTTTGGAGGATCTGTTCAAT
TTCTGCAACAGAAAGTTCTCTCTGAAGACTGTCCTGC

Sequences in the Contig:

SY0AAA39YD09FM1 SY0AAC34YB06FM1