Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4487
Length(NT) : 971
Best Gene Model Blast : Link to GSTUMT00008208001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE59811.1| Score: 338 E_value: 5e-41
KEGG Definition: predicted protein
Accession: aor:AO090026000343 Score: 338 E_value: 3e-41
KOG Definition:
Classification: [Transcription].
Kog Number: KOG4274 Score: 135 E_value: 7e-09
PFAM Definition: LSR, Lipolysis stimulated receptor (LSR). The lipolysis-stimulated receptor (LSR) is a lipoprotein receptor primarily expressed in the liver and activated by free fatty acids. It is thought to be involved in the clearance of triglyceride-rich lipoproteins, and has been shown in mice to be critical for liver and embryonic development..
Pfam Number: pfam05624 Score: 115 E_value: 1e-06
Swissprot: Q8W234|SEUSS_ARATH

Sequence:
>Contig4487
TTGGCTTGGACACTCAGTCCTTGGATTGTATCGGTTTTCCGGGCACCTTT
CGGCATTTGATGCTAGTAAAGAATCAAACGATATAGATCGTTGGCGGAGG
TTCGTAGCAGAGTTCTACGCACCATCTGGAGTGATGCGACAACGTCTGTG
GCATAACAACACACGGGAAACCAAGCAGTTTGAAGTAACCACCCAGGTAC
TGGGCGAGGTATTACTTCGTCCTATTCGGGTCAGGAGTTCAAAATATCCA
GATAGTGCTGGAAAACGTCCGGGAAAAGGAGCTCGCAAACCAGTGTCATA
TTGTAGAGTGCCCAAAAACGAGCTTCATATATTGGTTTGGGAATGGATTG
CACTTGGTTGCTCGTGGAGGCCTGCGGGCGACATTTAACGCGAGTTCCAA
AATGGAAGAATTGGACTTCCAGGTCGAGGAGCACTCGGAATACGTCCCTC
GAAACTTTGGTCAAGATTCACCAGATATTATGAAATCTTCTCCGGGTAGC
AAATCACTAGGCAAACGTCCGTCGCAGCAGGGACACGCATCAGAAAATAT
AGTAAACAATTATGGCGTACCCCACGCAGTGCTTCAATGCTTAGAGATAT
CGGAAACAATGTCGCAAATGCGAGACTTGTTCAATTACTCACACTTGAAC
CCCGCTCTTGCTCCACGACAAGCTCTGCAAAGCTATGTCAGCCAACAGCA
GCAACAGCAGCATGCTCAGCAGCAGCAGCACCTGGCGAACCAGCACGCCC
AACAGCAGCAGCAGCAGCAGCAGCAGCAGGCTCAAGCAGCGGTGATGGCG
GCAACAGCACCCGGACTACAGGTCCAACAGGGTCACCCAGGTGGCCATGC
TGGTCCAGGTATGCTTCAACATCCTGGGCAACATCTGGGCGTGCCGGGTG
GTGTACCAGTCGGGATGAACTCGCCCTCGGCAGATGGAATGAGAATGGGT
GTTCCTCCATCACCACATATG

Sequences in the Contig:

SY0AAA45YA07FM1 SY0AAC34YB03FM1 SY0AAC47YO22FM1
SY0AAD34YL03FM1 SY0AAD44YN18FM1