Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4486
Length(NT) : 829
Best Gene Model Blast : Link to GSTUMT00007531001 E-value : 1e-116
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: TT_ORF1, TT viral orf 1. TT virus (TTV), isolated initially from a Japanese patient with hepatitis of unknown aetiology, has since been found to infect both healthy and diseased individuals and numerous prevalence studies have raised questions about its role in unexplained hepatitis. ORF1 is a large 750 residue protein..
Pfam Number: pfam02956 Score: 107 E_value: 8e-06

Sequence:
>Contig4486
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTTTTTTTCTTGATGAGGTT
TTCTGTTTATTATTATTATTCTTTTACTATCATACTTGTATTTGTTTGAT
TGTTGACTTGTTTGTATTGGTCGGTCTGGCTGTATAAGTTATTGTGCGTT
TCATACCGGTATCATACGTACCTATCATATCATATCGTGCCTGCTATAGT
AGCTGCCTACTTACCTACCGGTACCTACCTACCTCCGTATAGCTCTTCGT
CTTCTCCCACGGTATTTTCGTGCAAGCTCGACAACAGCAACGACCGAGCG
ACGGCCATAACAGCAACTTCTCCAAGCATAAATATTATGGCACCGCGCGG
TAGAGGTGGAAAGTTCGGCAAGCCTACTCGTGGTGGCGGCAAGCACTTCT
CGAGAAATCTAGCACCCCTAGATAACGACGATGGCGAGAGTATTCCAGAG
GGAATGTGGGGCGAACCTCGCGACCCGAAACCCGAAATCCCCTCCTCCGA
GGACGAAGATGAGGAGGAAGAGGAAGGAGAGGAAGGAGAAGGAGAAGACG
CGGACAAGCCCGAACTAACCCGTGAAGAACGCCGCGCGGCAAAACAAGCC
CGTAAAGAAGCCGCTCGCGCCAAATCCACCGGTACCGTCGGTCAATCCTC
CCTCCCTTCTTCTGGGGATGAAGACGAAGAGATCACCACCCCCGCCGTTG
AAAAGGCTAGGAGGAGTGTTATCGCAACGGCGAATCCCAACGCTCCCGGT
AGCTCCGATGGAGGTGGAGGTGGAGGTGGGGGAGGAGGAGGGGGCAGGGG
GCTGACGAGGAGGGAGCGGGAAGCGATAG

Sequences in the Contig:

SY0AAC34YA21FM1 SY0AAC43YJ15FM1 SY0AAD21YA10FM1
SY0AAD46YG09FM1 SY0AAD51YK24FM1