Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4485
Length(NT) : 523
Best Gene Model Blast : Link to GSTUMT00006446001 E-value : 1e-37
Numbers of ESTs : 7

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG4752 Score: 127 E_value: 2e-08
PFAM Definition: Ribosomal_L41, Ribosomal protein L41..
Pfam Number: pfam05162 Score: 126 E_value: 3e-08

Sequence:
>Contig4485
TTGGATCATCGCCAAGATAACGTGAGTCTCCCACGAATCTCACCTTGGGC
CTGTATTGGATACTAACGACGCCAAGATAACTTTACATCTTCCACGATGA
GAGCTAAATGGAGAAAGAAGCGCGTTAGGCGTCTTAAGCGAAAGAGAAGA
AAGACTAGAGCTCGCAGCAAATAAACAACAACTCACCCTTACCTACCCAT
CACCGAAAATAACTTCCTAAAAAAAACCCCTCTTCTTATCTTCGAAATTA
AGACGACACCTCACCACTGCCAACAACAGCAACAACAACAAAAAACTTCG
AGTCTCGAGTCGGAAGCAATTGGGAATCGTGGAGAGGAAAATAACTGGGA
ACGCATAACTAGGGATGAAGTTACGATTCAAACAACCGAAGTGGGTTTGA
CTTCTCGGTCGAGGGAACCCAGTTGATTATTGGGAAGCGTGTTTCTAAGG
CTTTGTCACTTTTTTTTTTTCCTTTGCGATGCTATCTAAACAGACTTCAA
TGAAAAAATGGAGCGGGAAAACG

Sequences in the Contig:

SY0AAA50YI12FM1 SY0AAA53YH01FM1 SY0AAB37YI13FM1
SY0AAB54YK21FM1 SY0AAB55YC06FM1 SY0AAC33YP12FM1
SY0AAC34YA16FM1