Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4483
Length(NT) : 658
Best Gene Model Blast : Link to GSTUMT00003074001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein SNOG_00689
Accession: ref|XP_001791366.1| Score: 807 E_value: 1e-84
KEGG Definition: hypothetical protein
Accession: ncr:NCU01956.1 Score: 803 E_value: 2e-84
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG0980 Score: 545 E_value: 1e-56
PFAM Definition: ANTH, ANTH domain. AP180 is an endocytotic accessory proteins that has been implicated in the formation of clathrin-coated pits. The domain is involved in phosphatidylinositol 4,5-bisphosphate binding and is a universal adaptor for nucleation of clathrin coats..
Pfam Number: pfam07651 Score: 436 E_value: 5e-44
Swissprot: Q9P6L5|SLA2_SCHPO
Gene Ontology:
GO:0030479 = Cellular component: actin cortical patch
GO:0051285 = Cellular component: cell cortex of cell tip
GO:0032153 = Cellular component: cell division site
GO:0005515 = Molecular function: protein binding
GO:0042815 = Biological process: bipolar cell growth
GO:0030866 = Biological process: cortical actin cytoskeleton organization and biogenesis
GO:0006897 = Biological process: endocytosis
GO:0030950 = Biological process: establishment and/or maintenance of actin cytoskeleton polarity
GO:0007163 = Biological process: establishment and/or maintenance of cell polarity
GO:0031505 = Biological process: fungal-type cell wall organization and biogenesis
GO:0008104 = Biological process: protein localization

Sequence:
>Contig4483
TTGGGGGACAACTTTGTACAAAAAAGTTGGAACCCTTCCTCTCTGAATAC
CAAAGCTTTGAGATACCGAAAAAATCCATCCTTTGCTATCATGGCTTATA
CTGGGTCTACACGGAACGTGGACATGAGCAGATCCGAATCTGACCTCGTG
ATAAACATTAAGAAGGCTACCAATATGGAGGAGACCGCTCCTAAACGAAA
ACATGTCCGTTCTTGCATTGTTTACACATGGGACCACAAATCGTCGCAGT
CCTTCTGGGCTGGTATGAAAGTGCAGCCTATCATGGCGGATGAGGTCCAG
ACGTTCAAGGCGTTGATAAGTATCCACAAAGTTCTCCAGGAAGGTCACCC
TGTGACAATTCGTGAGGCTCATGCACATACTGGGTGGTTGGAGTCTCTGA
CCCGAGGGGTAGCCGGGGAGGGGCTACGGGGATACGGTCCTTTGATTCGG
GAATACATTTATTTCTTGTTGGCAAAGCTGGCCTTTCATAGGCATCATCC
GGAATTTAATGGGGTGTTTGACTATGAGGAATATATTAGCTTAAAGAGCA
TTAACGATCCGAACGAGGGATACGAGACTATCACCGATCTCATGACATTG
CAAGACCAGATCGATGCTTTCCAAAAGCTTGTCTTCTCCCACTTCCGCCA
TGGTGTCA

Sequences in the Contig:

SY0AAA45YL13FM1 SY0AAA59YG16FM1 SY0AAC34YA05FM1
SY0AAD5YB21FM1