Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4481
Length(NT) : 1044
Best Gene Model Blast : Link to GSTUMT00006766001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: calcium/mangenease P-type ATPase, putative
Accession: ref|XP_001275246.1| Score: 798 E_value: 1e-114
KEGG Definition: Ca2+ transporting ATPase [EC:3.6.3.8]; K01537 Ca2+-transporting ATPase
Accession: aor:AO090001000706 Score: 798 E_value: 1e-114
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG0202 Score: 701 E_value: 1e-74
PFAM Definition: Cation_ATPase_C, Cation transporting ATPase, C-terminus. Members of this families are involved in Na+/K+, H+/K+, Ca++ and Mg++ transport..
Pfam Number: pfam00689 Score: 345 E_value: 3e-33
Swissprot: P13586|ATC1_YEAST
Gene Ontology:
GO:0000139 = Cellular component: Golgi membrane
GO:0005509 = Molecular function: calcium ion binding
GO:0005388 = Molecular function: calcium-transporting ATPase activity
GO:0015410 = Molecular function: manganese-transporting ATPase activity
GO:0006816 = Biological process: calcium ion transport
GO:0006828 = Biological process: manganese ion transport
GO:0006486 = Biological process: protein amino acid glycosylation
GO:0045045 = Biological process: secretory pathway

Sequence:
>Contig4481
TTGGCTTTGCCCGCACTTCTCCCGAACATAAGATGAAAATTGTGCGCGCA
CTTCAGTCGCGGGGAGAAGTTGTGGCCATGACGGGTGATGGGGTTAATGA
TGCCCCTGCGCTTAAAATGGCAGATATCGGCATCAGCATTGGATTGCAGG
GAACCGATGTGGCTAAAGAGGCAGCTGATATGATTCTAACCAACGACGAC
TTCTCCACTATCCTTAGTGGCTATTGAAGAAGGCAAAGGAATCTTTTACA
ACATTCAAAATTTCCTAACCTTTCAACTCAGTACCAGCATCGCCGCCTTG
AGCTTGGTTCTTTTATGCACATTTGTCGGACTGCCCAACCCATTAAATCC
CATGCAAATTTTATGGATAAATATCTTGATGGATGGCCCCCCCGCACAAT
CCCTAGGAGTGGAACCAGTAGACCCAGCCGTGATGACGCGACCACCACGT
TCCCGCAACGAGCAAATATTAACCAGACCCGTCCTCTTGCGAATCTTCAC
TTCTGCACTAACTATCCTACTCGGCACGATATTTGTCTACGTCCTGGAAA
TGCATGATGGTGTTGTCACAGCACGTGATACCACCATGACCTTCACCTGT
TTCGTTCTGTTTGACATGGCGCTCGCGTTGTCCTGTCGCTCGGAATCGAA
ATCGATATTGAAGGGCGAGATCAAGATTTTCGGGAACAAAATGTTCAATT
ATGCCGTTATCGGATGTCTCGTCGGACAGATGGCGGTTATTTATGTTCCC
GGCTTGCAGAATATATTCCAGACGGAAACGCTGTCGTTTAAGGATTTGGG
GATTTTACTAGCGATCGCTACTTCGGTATTTTGGGTCGATGAGGGGAGGA
AGTGGGCCCAGAGAAGAAGGGAGTTTGCTGGCGGGTATAGTGGGAATGTT
TGATAGGATTTGGAATAGAATTACAACGAGTCATTGCAAGAACCTTTTAG
TCATCTGCTTGTTTCTTCCTGGGGAGGGGTTCCTTTCTCTCTCTTCCATA
AAGCTCTAATGGGTATTTGGGGTTTTTTCTTTTTTTGGGGTTCG

Sequences in the Contig:

SY0AAC33YO08FM1 SY0AAD47YN02FM1