Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4480
Length(NT) : 755
Best Gene Model Blast : Link to GSTUMT00004930001 E-value : 1e-128
Numbers of ESTs : 2

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001543333.1| Score: 457 E_value: 7e-44
KEGG Definition: hypothetical protein
Accession: ani:AN3547.2 Score: 392 E_value: 1e-36
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG1840 Score: 185 E_value: 6e-15
PFAM Definition: No Hit Found
Swissprot: Q7Z494|NPHP3_HUMAN
Gene Ontology:
GO:0005515 = Molecular function: protein binding
GO:0048496 = Biological process: maintenance of organ identity
GO:0045494 = Biological process: photoreceptor cell maintenance

Sequence:
>Contig4480
TTGGAAAAAGTACGCCGAAGCGGAGATTATGCATCGACGTGCATTGGCGG
GTAGACAGAAAGCCCTTGGAAGAGACCATCCGGATACCTTACAGAGTGCC
AATAATCTAGGCGAAACACTACATCGCCGGAAAAAGTACGATGAAGCTGA
GGTTATGTATCGACATGCGTTGGGGGGGAGAGAGAAGGCTCTTGGGAAAG
ACCATCCGGATACATTATTAAGTGTCAGTAATTTGGCTCTCTTACGTCAG
AAAAAGAGAAAGGGCCACAGAACCAAACTTTCAAATCGGCCTGTGGTGGA
AGGGAGAGAGGTGGAATTCTCCCCAGGTGACCCTGGCCCCTCGCTGGGTA
TCGCTGCCATAGGTGGGGGGCTGAGTGGACAGAGAGACGTTGAGGCAACA
GACATGGCGCGTCAGGTTGTACCGGCGGATAGAGATGTGGTACTCGGGCC
ACCACACGCAGACGTCCTACTGGGTGCTGATGACCTAACTGTTACTCTGC
TTGATCAGAAGTACGCAGAAGAGGAGATCATGTATCGACATGCCTTGGAG
GCTGTGGAGAAGGCTCTGGGGCCCGATCATCCCGTTACCCCCGATACCAT
GAATATGCTAGGCGAAACGCTTCTGGATCTGAGAATGTATGATCAAGCAG
AAGCCGTTTGTCGACGCGCATTGGCGGGTAGAGAGAAAGTTCTCGGAGCA
GACCATGGATCTACCCTGACAAGTGCCGATAACCTCGGTCGGGCTCTACA
TAATC

Sequences in the Contig:

SY0AAC33YO06FM1 SY0AAC40YG19FM1