Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig448
Length(NT) : 1410
Best Gene Model Blast : Link to GSTUMT00000125001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein An17g00210
Accession: ref|XP_001398250.1| Score: 605 E_value: 1e-60
KEGG Definition: hypothetical protein
Accession: ang:An17g00210 Score: 605 E_value: 7e-61
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2742 Score: 294 E_value: 3e-27
PFAM Definition: GFO_IDH_MocA, Oxidoreductase family, NAD-binding Rossmann fold. This family of enzymes utilise NADP or NAD. This family is called the GFO/IDH/MOCA family in swiss-prot..
Pfam Number: pfam01408 Score: 245 E_value: 2e-21
Swissprot: O13991|YEG9_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig448
TTGGCCATACTCACCGCCAACCAGCAATGTCTCCCCGAAAAATCGCCATA
ATCGGCTATGGATTCTCCGCCAAAATCTTCCACATACCCTTCATCCAGCA
CAATCCGAATCTGACAATCTCGGCGATCATTCAGCGAAATCCGACGCCAG
GGAATGACGCCGCTAAAGATCATCCAGACGTCAAAGTCTACAGGTCCGTG
GAGGAGTTCTACAAGAGTGATGGTGAGAGTAAGGTCGTTGTTATAACTAC
AAGCAATGATACCCACTTCCGTTACTGTAAGGAAGCGATTGAGAAGGGGA
AGGATGTTATTGTCGAGAAGCCGCTTACAATTAGGAGTGCCGATGCGGAG
GAGTTGGTGAACTTAGCGAGGAAGAAGGGGGTTGGGATTAACGTTTATCA
GAATAGAAGATTCGACTCCGACTTCCTTACCCTCGCTAAAGTGCTTCCAA
GAGTTGGGGAGCTAGTTTCTCTAGAAACACATTACGATAGATACAGGCCT
GATACTACTCCCAACCCCTCCAAGTCTTGGAAGTCTGTACAAGCACTCGG
AAACGGCACCCTCTTCGACCTTGGCGTGCACCTCTTAGACCAAGTCGTTT
ATCTTTTCGGCATGCCCCAACGCATCTTTGGCGATGTCCGCGATGAGCGC
GGCTGCAGTGTAACCCCATCAGCAATCTGGGGCCAGGAGGGCTTCGTCGA
CGATTTCTTCACCGCGACACTATACTACACCTCCACCCCGCCTCGCAAAA
AGCCGTTTACTGTGCGGGTAGAGGCTTCCACACTATCCTGTCAAACACCA
CAATTAAGGTTCCTGCTCAGGGGTGTGGACGGTAGTTGGATTAAACATAA
TCTGGATACTCAGGAGGCACAGTTGATGTCCGGGAGGATTCCAGGGACAG
AAGGGTTCGGTGTTGAGGAGGAGGAGCATTTCGGGAAGCTGGAGTTGAAG
GACGGGAGTGTTGAGCGGACGGTCGCTGAAGTGGGTGATTATGGAAAGTT
TTATGAAAAGATTGCGGAGGGGGGTGTCGCTGTTCCGGCGGAAGAGGCGG
TGAGGGTTATCAGGTTGGTAGAGTTGATTGGGGAGAGTAGTCGGTTGGGC
AAGGTTTTGGATATCGCAGCTTAATGAACGGAACGTTACGGTATATTATG
ATAATATTATGTGTCTTTAGGGGTTCCGACTCCGGATAAACACAGTTGTG
AATGCATTTCTTTCTTTTAAAATCCACTCACACTTGCAGTTTTGCGGGTT
CAGCGACCAATTGGTCAGGATGTTTCCTGCTTATCGCATCTCACTTTCGC
TGATTCACTGCACCTATCCCAGTGCGCAACCGATAAGAAGTGCCTGTGTT
TTGAAACCCGAATTCACCCAATTGGCCAAGCAATTCTTCGAATCGACCAC
AGCGGAAAGC

Sequences in the Contig:

SY0AAA24YD18FM1 SY0AAA24YD18FM2 SY0AAA24YD18RM1
SY0AAC51YA20FM1 SY0AAD39YI12FM1 SY0AAD53YC02FM1
SY0AAD7YK02FM1