Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4479
Length(NT) : 1270
Best Gene Model Blast : Link to GSTUMT00000261001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein AN3012.2
Accession: ref|XP_660616.1| Score: 1072 E_value: 1e-115
KEGG Definition: hypothetical protein
Accession: ani:AN3012.2 Score: 1072 E_value: 1e-115
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P52918|MSN5_YEAST
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0008262 = Molecular function: importin-alpha export receptor activity
GO:0006611 = Biological process: protein export from nucleus

Sequence:
>Contig4479
TTGGATTTGATGCTAGTGTACGAGGGCTTACAAACAAAGATCAATGAGAT
TATCTCTACGGAGAATGTAGATGACCGGACTCGGATTGCGTTCCATACCT
TTTTATTTACTATCAACCACCGGACGAAGAATATCGACCCCGCGATACGA
CAGTCTAGGCTTGAGAGCTATATCCATCCAGTTCGTGAAACATGGAGGGA
CCCTGGTCTCACCGAGTCACTACAAACATTCCAAGGCTTTTGTACAATCT
TGGGTCTCGACAAAGTCCAAGAATACCTTATCTCGAGAAGAGTGAACGAA
ATCCCGGATTTTACGAAACACGTGCTAGATACCGAGGGCCAGGCTTTACA
AAACGAATTGGCGGAGAAATTCAAGGCCTTGCCGATAAGGGCTACAAAGG
CGTTCCTCGCAGTTTCTACTGAACAGCTGCGGAAGCCCTCGAATGCCTAT
AACATTGCGTGCGCGCTTTGGCATGAATCAATACCCATGATTTTGCCCAA
TCTCCTGCAATTTTTAACTCACGCGCATGCATTTCATAACGCGGGGAATT
GGGCAGGGCTCCAACCGGAACTCCAGGCGGTTATACGCAAAATTTTGACT
GATAGGTTCTGGCAAGCTGGGATATCTACTGGGAGTAGGGACGAATTCTA
TGAAAATGTGACGAAAACAAAGACCACGATGGAAGGGCTCGCTTCGTCAA
TAAGGGGTGCAATCAGGATGGTGCGCGAGGCTTGTTATTCCATACTCTGG
TGCATGTCAAGGTTGGACGTTCATTTTTACGGTCTCAACGAGCTTCCGGG
GCCGCTTGCGCTGGCACTTTTCGCAGATGCCCATGCGCTCAGTTCGCATC
AAATGTCAATCTTGTTAAACATGACCAGATACATCATTGATGACTGCCCA
ACCACCCTCAGGGCGCATTTTCTGACTCCTCTTCTCGCTAGTTTGTTTAC
GCAGGTGGATCGCAAGATTAGTGGCGAATGGGATGAACTTATTAGGAAGG
GGCAAATTTCTCTGGGGGAAGACAAGCTTGCGGAAGAAATGAAGGAAGAG
AGCATATTGAGACAGCTTACATATACTGCTGTCTTGATTGTTGCTGGGTT
ATTGGATCCGCAGCGCCCTGGCGAAACTGTTAACACAAACTCTGGATTCC
TTGACCAGCTGGCGCTGCCTGAAATGCAGGCCGCTGGGCCCGGTGAACAA
ACTATGAGAGAGTTCATCCTTTCGAGCGATTGTGTCTTGGAGCCGTTGAT
TTTGTTTTGTACACATGCTC

Sequences in the Contig:

SY0AAA43YN17FM1 SY0AAB5YP01FM1 SY0AAC33YN21FM1
SY0AAD46YA20FM1