Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4478
Length(NT) : 780
Best Gene Model Blast : Link to GSTUMT00000033001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SS1G_00700
Accession: ref|XP_001598611.1| Score: 756 E_value: 2e-78
KEGG Definition: hypothetical protein
Accession: ang:An07g03760 Score: 748 E_value: 7e-78
KOG Definition:
Classification: [Transcription].
Kog Number: KOG2039 Score: 286 E_value: 1e-26
PFAM Definition: TUDOR, Tudor domain. Domain of unknown function present in several RNA-binding proteins. copies in the Drosophila Tudor protein..
Pfam Number: pfam00567 Score: 230 E_value: 4e-20
Swissprot: Q9Y7U7|SND1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>Contig4478
TTGGATTATTCTGCTGAGAGGTCCGGAAATGCAAACGAGCTTTATGCTAC
CGAAAAGAGGGCCAAGGAAGCAAGGAAGGGGCTTTGGCATGATTGGTCCC
CTGAGAATGATGAAGAGAACAGCCATGATTCCCCGGGGAACATTAACACA
ACTGAGGAAGTCATCGAACCAAGGACCGATTATAGAGATATCATTGTCAC
CAATATTGACGATCACGGAAGGTTGAAGGTTCAGGTTGTGGGAACTGGGA
CTTCAGCGCTCGAGGAAATGATGACTGCCTTTAAGAATTTCCATCTTTTG
CCCCAGAACAACAAGGGACTGGAGGGGCCGCCTCGGGTTGGTGAATTGGT
CGCAGCGAAGTTTACAGACGATAACTCCTTCTATCGCGCCCGCGTCCGTC
ATGTCAATCGTGAGGCTAAGGAGGTTGAAGTGATGTACATTGATTACGGT
AATTCTGAGAAGCTGCCGTTTTCGAGACTTCGTCCTTTATCCCAGCCTCA
GTTTCAGCCTACCAAGTTGATGCCTCAGGCCATGGATGCATCGCTCTCAT
TTATCCAATTTCCTACCGCCCTCCACTACGCTCAGGAGTCTGTCGACGCG
CTTGGTCAGATGACCAATGGGAAGCAATTAGTTGCTAACGTTGATTATAT
CGGCTCTGATGGAGCACTCTACCTCACCTTGTATGATCCTAAGGAGAGCG
ATCGCTCAGAGAGCAGCATTAACGCAGAGTTGGTATCTGAGGGGTTAGCC
ATGGTTGCCCTGAAACTGAGACCCTTTGAA

Sequences in the Contig:

SY0AAC33YN19FM1 SY0AAC3YP18FM1 SY0AAD49YM08FM1