Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4476
Length(NT) : 725
Best Gene Model Blast : Link to GSTUMT00002340001 E-value : 1e-174
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_05348
Accession: ref|XP_001593920.1| Score: 281 E_value: 2e-27
KEGG Definition: meltrins, fertilins and related Zn-dependent metalloproteinases of the ADAMs family
Accession: aor:AO090003001107 Score: 209 E_value: 2e-18
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4476
TTGGTGCACATCTCGAGACCTGCAATGCAAGACGGTTATGGGGCAGTACC
GGAGCAACAGTACACATTCATGCACGGATACAGATTGCCAGCTGACTTGC
GCATCCCCGGAGTTTGGCCCGGGAACCTGCTTCCGGATGCAGCAGAATTT
CCTCGATGGGACTCCATGTAACGGTGATGGGAGGTGTAAGGCTGGAGTAT
GCAGTGGCTCGTCAACACTTGGCCAAGTTAAGAGTTGGATCAATAAGGTA
CCCTCCCCCCTTCCCTCACTAGAGCCAGAGCCAACAAGTATAGAACAAAA
ACATCGTAATAGGCGTATCAGTCGGTATAGGCGCCCTGGTAATCTTTTCC
ATCTTCTCCTGCATATGGAGTTGCTGTCGAAGAAGGCGAGCACGCAAGGC
CGCGTTGAAGAGCCCGCCGCGTCCACCCACAGGTGGGTACCAACCGCACG
ACCGGGCATGGCACAGACAACGTGATGCAAACACGGGCGTGTACCCTATG
CCCCCGCCACTATCGCACGCGTCTCATCAAACGAGGAGTCCGCCCGCCTA
CGGCAATGCGGGCTTCTCGCCTGGTATACGATCGGATCGATACGCTTGAA
GTCAAGTAAAGCATGATTCTGGGTGTTTCTTTGCGCACTTGTACATGATA
ACGATACGATGATTAGTGTTTTTTTTTCTCTCTTTTTTTATTCATCTCTT
TTTTCTCCGTTGAGTGGTATTTGAG

Sequences in the Contig:

SY0AAB44YC11FM1 SY0AAC33YN06FM1