Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4475
Length(NT) : 1039
Best Gene Model Blast : Link to GSTUMT00001593001 E-value : 1e-88
Numbers of ESTs : 3

Blast Results:

Nr Definition: fructose-bisphosphate aldolase
Accession: ref|XP_001542964.1| Score: 205 E_value: 6e-33
KEGG Definition: fructose-bisphosphate aldolase, class II [EC:4.1.2.13]; K01624 fructose-bisphosphate aldolase, class II
Accession: afm:AFUA_3G11690 Score: 243 E_value: 5e-29
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG4153 Score: 194 E_value: 9e-16
PFAM Definition: F_bP_aldolase, Fructose-bisphosphate aldolase class-II..
Pfam Number: pfam01116 Score: 177 E_value: 9e-14
Swissprot: Q9HGY9|ALF_ASPOR

Sequence:
>Contig4475
TTGGCAACTCTACTCCACACCTCTTGTACGAAACTCTCCTCACTCCTCTT
TCTCTATTGTTCACACACGCAATACAAAGTTCCCTCATTACCATCAGAGC
CAACTCTATCCACTGCGTAAAACCCACCTTTCAGTCATTACCGTTGCAAC
TACTACCGGTTTTATCCTGTCCGTCTTCCTCAATTTCCAACAAAAATTGA
TTCACAGAAGAGCCCCCGGAGCTCCCGGAGAGAAAGGATAGCACTTCCAC
CAACTGGCCCATTTCCTTGCTCCCAATTTAGAGCTGATTCGCAGTGTTGA
AGTCATGGAGAACCTCCTTCACACGGGTAGACATGGTCTTTTCGCCTTCA
CGGACCCAGACGCGGGACTATTCAGGTATCATATCACGTTAATTCTATAA
GTCAGGTAGGCAGGAGGGGAAGGTGGGGGCTAACTCGAAGTATTTCTTGG
TATCCAGTACGTATAGGAAGGGAATTGGAAACGTACGAACAAAATCACGG
ATACCGGTTAAGTGTGCGTATCTATAAGATATCATACCTTGTATTAGCTC
CCCCTCCCCCTTTCTACGTTTCTTGGTGGAGAAGGGCATACTGAAGGTCG
GTATCCAAAATAACCTTAACAACCCCGTGCCCAATAGCTGTTTCAAACCC
AGCCTTAATATCATACTCCCGGATCCACCGTGGAAGACCAAAATAGTCGC
TTGTCCTCCCCATCTCCCCCTCCAATCTTCCGCTTTGGGAATTCCTGATG
CCTCCCGAGTAGCTCTGGGTGCAGCCTCACGTTGCCGGGCTTGTAAACCC
CATACACATTCCCGAACCCGGCTGCGATGGAAAAGTACGGAGAGACGGGC
ATCAATGTGCTGTACAGTACACCTCCTAGATATCCTCGGGCTGCGTATAT
AGCGCACTATTATCCACGCCGGTGTTATCGACGCCATCCTCCTCACATCC
GGTGATCCTGATCTCCATTTCCAACCATTGCTTCATCGGCGCCGGGCGGG
GCAGGTACTCCTTCGTGGTGGCGATGTTGAAGTCCTTGT

Sequences in the Contig:

SY0AAA17YJ08FM1 SY0AAC33YK15FM1 SY0AAC33YM09FM1