Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4474
Length(NT) : 579
Best Gene Model Blast : Link to GSTUMT00008772001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein An01g10820
Accession: ref|XP_001389499.1| Score: 518 E_value: 4e-51
KEGG Definition: hypothetical protein
Accession: ang:An01g10820 Score: 518 E_value: 2e-51
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG2256 Score: 487 E_value: 4e-50
PFAM Definition: Noc2, Noc2p family. At least one member, Noc2p from yeast, is required for a late step in 60S subunit export from the nucleus. It has also been shown to co-precipitate with Nug1p, a nuclear GTPase also required for ribosome nucleus export. This family was formerly known as UPF0120..
Pfam Number: pfam03715 Score: 483 E_value: 1e-49
Swissprot: P39744|NOC2_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion
GO:0030690 = Cellular component: Noc1p-Noc2p complex
GO:0030691 = Cellular component: Noc2p-Noc3p complex
GO:0005515 = Molecular function: protein binding
GO:0042255 = Biological process: ribosome assembly
GO:0000054 = Biological process: ribosome export from nucleus

Sequence:
>Contig4474
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGATACATCTGAGAAACAG
TATTACCAATAACTCAAAGGTTTGTAACGGTAACTTACTAACCACACATT
ACCATCTGCTGACCCACAAAACCCAGGACTCTTACAAGACTGTCTACAAC
TGGCAATACGTCCACTCCCTCGACTTTTGGTCCCGTGCCCTTTCAGCTCA
CTGCGACGGATTCAAAGAAGCTGAAGCGGGCAGAGAGTCCCCCTTGCGGC
CGTTGATCTACCCATTGATCCAGGTAACCCTCGGCGCCATCAAACTCATC
CCAACGGCTCAATACTTCCCCCTGCGCTTCTACCTCCTTCGCTCCCTCCT
CCGTCTCTCAAGAGCAACAGGAGTCTACATCCCCCTAGCCTCCCTCCTCT
TTGAGGTCCTCTCCTCAACCATCTTCAAGAGGAAGCCTAAGCCATCGACC
CTCCGCCCCCTAGACTTCAGCACAACCATCCGCGCGCCAAAATCCTACCT
GCCAACAAAAACCTACCAAGATGGCGTTGGCGAGCAAGTCGTAGAACTCC
TCTCGGAGTTCTTTGTCCTGCACGCCAAA

Sequences in the Contig:

SY0AAA26YN14FM1 SY0AAC33YM03FM1