Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4473
Length(NT) : 222
Best Gene Model Blast : Link to GSTUMT00004364001 E-value : 5e-29
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4473
TTGGGGCGCGGTACTACGGGGAGTCCGGGGACCCAAGTTTTGTTCGCATT
AATACCTGCCAGGTAGACAGAACACGATATTCCTGTCGATTCGACTAATC
AATCATGAAAACCACCAACAGGACCGGGTCCAAAGGAAATCCAAACTTTG
CTCTATTGAGCACTTTCTAGTCTCTAATCCTAGTCTTAGTCTTGAACTGC
CAATCGACCCTTTTCCTCTGGC

Sequences in the Contig:

SY0AAC19YN12RM1 SY0AAC31YA17RM1 SY0AAC33YM02FM1