Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4472
Length(NT) : 650
Best Gene Model Blast : Link to GSTUMT00011707001 E-value : 1e-104
Numbers of ESTs : 4

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE61590.1| Score: 244 E_value: 3e-19
KEGG Definition: predicted protein
Accession: aor:AO090102000572 Score: 244 E_value: 1e-19
KOG Definition: No Hit Found
PFAM Definition: TOM13, Outer membrane protein TOM13. The TOM13 family of proteins are mitochondrial outer membrane proteins that mediate the assembly of beta-barrel proteins..
Pfam Number: pfam08219 Score: 212 E_value: 4e-18
Swissprot: Q8X0G8|MIM1_NEUCR

Sequence:
>Contig4472
TTGGCAATCCACCTCCCTTCCTCACCTCACCCCACCTCGCCACCATAAAT
CTATCTCAACCACAGCTTCACAACCAAACAACTGAACCGAAAAATGTCGA
CCGAAGCAACCGCCGCCACTCCCCAGCCTTCCTCCTCTACCACCTCCTCG
CCCATAATACTCTACAAACCGCCTACGATCCAGAAACTCCTCCGCACCGC
AGCGATAAACCTTGTGCTGCCCTTTATTAATGGTCTTATGCTGGGCTTTG
GGGAACTGTTTGCGCACGAGCTTGCGTTTCGATGGGGGTGGGGGGGCACT
CGGGTGTTTCCATCTAGTCGTGTTGCGGCACCGGGGGTTGAGGATAAGGT
GGATGAGCGGGGGCGGAAGGTGAAGGGGCGGGGAAGAGGATAGGGTTTTG
GAGGAGCTTACAGGTTTGGAATAGGGATGGGATGATTGCGGATGTGGGGG
AGGGGGTGTAAATACGGGGGTGGGAATGGAAGTTTAACTTCCTCTTTTTC
AGTTCGCTTGTTTGTCAGTTCGCTTGTTTGTTTTTGCGCAGTGGAGGTTA
TATACACTTTGCGGAATGGAGCGGACATTGAACATTGAGAACGAGGTGAA
ATGAGGGAGATGGGTGAATTGGGAATTTGGGCATTGTCTAGGGGGGTATT

Sequences in the Contig:

SY0AAA9YP20FM1 SY0AAC33YL16FM1 SY0AAD13YI16FM1
SY0AAD19YG12FM1