Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4470
Length(NT) : 3779
Best Gene Model Blast : Link to GSTUMT00001743001 E-value : 0.0
Numbers of ESTs : 151

Blast Results:

Nr Definition: hypothetical protein CIMG_05477
Accession: ref|XP_001246036.1| Score: 3831 E_value: 0.0
KEGG Definition: translation elongation factor eEF-3, putative; K03235 elongation factor EF-3
Accession: afm:AFUA_7G05660 Score: 3740 E_value: 0.0
KOG Definition:
Classification: [Amino acid transport and metabolism, Translation, ribosomal structure and biogenesis].
Kog Number: KOG0062 Score: 1464 E_value: 1e-162
PFAM Definition: ABC_tran, ABC transporter. ABC transporters for a large family of proteins responsible for translocation of a variety of compounds across biological membranes. ABC transporters are the largest family of proteins in many completely sequenced bacteria. ABC transporters are composed of two copies of this domain and two copies of a transmembrane domain pfam00664. These four domains may belong to a single polypeptide, or belong in different polypeptide chains..
Pfam Number: pfam00005 Score: 325 E_value: 3e-30
Swissprot: P25997|EF3_CANAL

Sequence:
>Contig4470
TTGGCCTCTCCTCTCCTTTGGCTTTGAATAGATTTCCGGTTTTTTTTGTC
GGGTTTTTTTCTTCCTCTATAGACGGGAACAAACAAAGAACACGAGGCCG
CACTCTACGCTGCAAGATCAACAGCCTACCACATTTTCACTATAACGCCA
AAAGAATTTTCAGGGAGCTGCCTTTCCCAGTCCTTTTTTCCCCTACACTA
TTTAGATCTTAGACTGCTTTTTGGTGTTTGATTTTTTCCCTTTCGCTTTT
CCTCCGCCACGAACAGTTTTTTTCGTCATCTTTCTATACCACTAGATCCC
CTTTAAACACAACATAAATGGCCCCTGCTCTCGATACAATGACCCCCTCC
GATGCCGTTGTCGCTTCGGAAAACCAAAAGTCCGTCAAGGTCCTCGATGA
GCTTCTTCAGAAATTGTCCGTTTCAAAGACAAAGGCTGATGCCACCTATG
CTGCCGAGAACTTGGCCACTTTCATTAATGGTCCCATTGAAGAGCACGAG
GTTCCTACAAAGATCCTCAACTTGATCAAGAAGCAGCTCGCGAACAAGAA
GGACGCCCTTGCTAGGGAACATGCTCTTACTGCCATCGCCGCCATCTGCT
TGAAGCAGGTTTCTCCCAGTATCGAGCCTTACATCGTTTCACTGCTCCCC
AATGTTCTCGCCGCTGTTGGGGACAAGATCACCGCTGTTAAGAATGCCGC
CGATGCTGCTTCCCTGAAGATTGTTGGCATGATCAACCCCAACGCTGTCA
AGGCTGTTCTTCCTGCCATCTCTCACTCAATCACCAAGGCTCAGAAATGG
CCTGAGAAGATGACCGCCCTCAAGTGCCTCGATGTTCTCGTCCGAACTGC
ACCTGGACAGACTGCTCTCCGTCTCCCTGAGCTTATCCCAACCGTCTCCG
AGGCCATGTGGGATACCAAGCCCGAGATCAAGAAGGCTGCTCGTGCTGCT
ATGGAGAAGCTTTGCTCTCTCATCTCTAACAACGACATCAACCGATTTAT
CCCTGAGTTGATCAACTGTATCGCTAAGCCTGAGAGGGTCCCCGAGACAG
TCCATCTCCTCGGTGCTACTGTTTTCGTCGAGAATGTCCAGGCGCCCACT
CTGTCCATCATGGTTCCTCTCCTCGAGCGTGGTCTTGCCGATCGTGACAC
CACCATTAAGCGAAAGGCTGCCGTCATTGTCGACAACATGTGCAAGCTTG
TCGAGGATCCTCAAATCGTTGCTCCCTTCTTGCCCAAGCTTATGCCCAAC
CTCCAGAAGAACTATGACAACATGGCCGATCCCGAGGCACGTGAGAAGAC
CAAGCAAGGTCTCGATACTTTGACCCGCGTTGGTGACGTCAAGGACGGCA
AGATCCCCGAGATCTCCACTGCCGGTGATCCTAAGGTTATTCTCGAGACT
GTTAAGACTGTCTTGTCAAACAGGAAGGACCTCGCTGCCAAGTTTGAGCC
TGTTCTCACATATATTGCTTGTATCGCCGGTAGCTTGGTTGATGAGAGGG
AGAACGAGGTCCTCATTTGGACCGAGCACACCGTCCCATACTTTGCTGCC
TTCTTGCCTGAGGGTGAGGCCCAGGGTACCGCCGAGACTTTGAGGAAGCG
TGCTGCCCCTGGTGCCGCTGAGGAGGAGGTTGATGAGGACGATGAGGAGG
GTGAAGACCTCTGCAACTGCACATTTAACTTGGCCTATGGTGCAAAGATC
TTGCTGAACCAGACCCATCTACGATTAAAGAGAGGCCAGCGTTATGGTCT
TTGTGGACCCAATGGCTCCGGAAAGTCCACCCTCATGCGCGCTATCAACA
ACGAGCAGGTTGAGGGCTTCCCCAAGAAGACCGAAGTCAAAACTGTGTTC
GTTGAGCACGATCTCGATTCTGCTGATACCGAGAAGACCGTCGTCGGATG
GACATTCGATAAGCTCGCCGAGACTGGTGCTGGTGTTTCCGTTGAGGACA
TCAAGACTAAGTTGGGTGAATTCGGTTTCCAGGAGACCATGTTTGATGCT
CCTATCACTTCCCTTTCCGGTGGTTGGAAGATGAAGTTGGCCCTTGCCCG
TGCTGTGTTCGAGAACCCCGATATTCTTCTCCTGGATGAGCCTACCAACC
ACATGGACAGACAGAATGTCAAGTGGCTCGAGCAATATTTGATCAACTCT
CCTTGCACATCCATCATCGTCTCGCACGACTCTGGTTTCCTTGATAATGT
TGTTCAACATATCATCCACTACGAGCGCTTCAAGCTTAAGCGTTACAGGG
GTAATCTCAAGGCCTTTACCGAGAAGGTTCCTTCTGCCAGGTCTTACTAC
GAGCTCGGTGCCTCCGAGATCAACTTCAAGTTCCCCGAGCCCGGTTACCT
TGAGGGTGTCAAGACTAAGGCCAAGGCCATCGTCCGTGTCTCCAACATGA
GCTTCCAGTACCCCGGTACTTCCAAGCCCCAGATTCGTGACATCACCTTC
CAGTGCTCTCTCGGATCCCGTATTGCCGTCATTGGTCCCAACGGTGCCGG
AAAGTCCACCTTGGTCAATGTCCTTACTGGTGAATTGATCCCAACCAGCG
GTGACATCTACACTCACGAGAATATCCGTATCGCCTATATCAAGCAGCAT
GCTTTTGCCCATATCGATAACCACTTGGAGAAGACTCCTTCCGAATACAT
CCAATGGCGTTTCCAGACTGGTGAGGATCGCGAGACTATGGACCGCGCCA
ACACCAAGATCACTGATGATGATGAGCAAGCCATGAACAAGATCTTCAGG
ATCGAGGGCACTCAGAGACGTGTCATCTCCATTTCTTCTCGGAGAAAGTT
TAAGAACTCTTATGAATATGAGTGCTCGTTTACTCTTGGAGAGAACGTTG
GACAGAAGGGAGAGAAGTGGATTGTGATGTCTACCTCCGACAACGCTTGG
ATCCCTCGCACCGAGCTCATCGCCTCCCATGCCAAGATGGTTGCTGAAGT
CGATCGTGCCGAGTCTATTAAGGCTGGTCAGTTCCGTCAGCTCATTCGTA
AGGAAATTGAGGCCCACTGTGCTCAATTCGGTCTCGACGCTGAGCTTGTC
TCTCACTCTCACATGAAGGGTCTCTCCGGTGGTCAGCGTGTCAAGGTCTG
TCTTGCCGCTTCGACGTGGCAACGTCCCCATCTTATCGTTCTTGATGAGC
CTACCAATTATCTCGATAGAGATTCACTTGGCGCCTTGTCCCGTGCTCTC
AAGGAGTTCCAGGGTGGTGTTATCATTATTACCCACAGCGAAGAATTTAC
GAAGGATCTCACTGAAGAAGTTTGGTCTGTTCTTGACGGAAAAATGACCC
CCTCTGGACACAATTGGGTTCAGGGTCAAGGCGCTGGTCCTCGTCTCCAG
GAGAAGGCAGGTGATGAGGATGTCTTCGATGCTATGGGTAACAAGGTTGA
GGGTGGCAAGAAGAAGAAGAAGCTCACTTCCTCTGAACTCCGCAAGAAGA
AGAAGGAGCGTATCGCCAGGCGAAAGAGGGGTGAGGAGGTCTTCTCTGAT
GAAGATGAGTAGTCGAGTCTATAGGGGAGGTGTCTCGAGTTTTTTCTTTC
TGTTTTTCCCTTGGTCTATCGGTCATGATACGATAATGATGAAAAGTGGG
GTTTGGGTTTTTCTTTCATGTTTACGGATGGTGGCGGGCTTGTGTAATTT
TTCCTGTTATTTTTTTCTTTTCTCTGGACTTGTCGTTTCACCATTCTTAG
AATAGAGATAAACTAGTTCTGTTAATACAAGTGAATGATGGTCATGTTTC
AATAAATATTGTTCCTTATCATCTGGATG

Sequences in the Contig:

SY0AAA10YF24FM1 SY0AAA10YG17FM1 SY0AAA11YE24FM1
SY0AAA14YN17FM1 SY0AAA15YK19FM1 SY0AAA16YG02FM1
SY0AAA18YP20RM1 SY0AAA19YM16FM1 SY0AAA21YC10FM1
SY0AAA21YD15RM1 SY0AAA22YA15FM1 SY0AAA23YE14FM1
SY0AAA23YI13FM1 SY0AAA23YI13RM1 SY0AAA24YE14FM1
SY0AAA24YE14FM2 SY0AAA24YJ03FM2 SY0AAA24YJ03RM1
SY0AAA24YP14FM1 SY0AAA24YP14FM2 SY0AAA25YN21FM1
SY0AAA25YN21RM1 SY0AAA26YP24FM1 SY0AAA27YI02FM1
SY0AAA2YC07FM1 SY0AAA30YG16FM1 SY0AAA30YL13FM1
SY0AAA31YI03FM1 SY0AAA31YO17FM1 SY0AAA32YA16FM1
SY0AAA32YF17FM1 SY0AAA32YO05FM1 SY0AAA33YE03FM1
SY0AAA33YJ14FM1 SY0AAA34YO01FM1 SY0AAA35YP04FM1
SY0AAA36YL01FM1 SY0AAA37YB19FM1 SY0AAA39YB17FM1
SY0AAA40YE05FM1 SY0AAA40YK08FM1 SY0AAA41YF13FM1
SY0AAA42YN20FM1 SY0AAA44YH01FM1 SY0AAA44YP08FM1
SY0AAA45YA22FM1 SY0AAA47YI15FM1 SY0AAA48YA05FM1
SY0AAA48YD08FM1 SY0AAA49YI20FM1 SY0AAA49YK11FM1
SY0AAA49YM21FM1 SY0AAA4YB08FM1 SY0AAA50YI15FM1
SY0AAA50YK17FM1 SY0AAA50YM16FM1 SY0AAA52YA02FM1
SY0AAA52YM03FM1 SY0AAA54YA21FM1 SY0AAA55YB13FM1
SY0AAA55YD12FM1 SY0AAA56YH17FM1 SY0AAA57YF23FM1
SY0AAA58YF06FM1 SY0AAA59YJ18FM1 SY0AAA5YG17FM1
SY0AAA60YI16FM1 SY0AAA60YI18FM1 SY0AAA61YF18FM1
SY0AAA61YG23FM1 SY0AAA61YL16FM1 SY0AAA62YD17FM1
SY0AAA63YD03FM1 SY0AAA6YB13FM1 SY0AAA6YM03FM1
SY0AAA7YB20FM1 SY0AAA8YC15FM1 SY0AAA8YG17FM1
SY0AAB10YO08FM1 SY0AAB11YA08FM1 SY0AAB11YO08FM1
SY0AAB12YH13FM1 SY0AAB15YF21FM1 SY0AAB15YN04FM1
SY0AAB18YI04FM1 SY0AAB18YJ23FM1 SY0AAB1YE07FM1
SY0AAB20YC03FM1 SY0AAB22YJ23FM1 SY0AAB24YJ15FM1
SY0AAB25YG08FM1 SY0AAB2YP09FM1 SY0AAB30YK05FM1
SY0AAB30YK06FM1 SY0AAB31YD12FM1 SY0AAB33YA21FM1
SY0AAB33YG01FM1 SY0AAB33YG23FM1 SY0AAB34YO02FM1
SY0AAB37YB19FM1 SY0AAB37YC19FM1 SY0AAB38YH10FM1
SY0AAB3YB21FM1 SY0AAB40YD15FM1 SY0AAB40YN04FM1
SY0AAB41YP08FM1 SY0AAB42YB18FM1 SY0AAB44YK24FM1
SY0AAB45YF12FM1 SY0AAB45YI11FM1 SY0AAB46YL10FM1
SY0AAB47YL24FM1 SY0AAB4YM06FM1 SY0AAB4YP17FM1
SY0AAB50YB10FM1 SY0AAB53YB13FM1 SY0AAB53YN08FM1
SY0AAB54YM01FM1 SY0AAB55YG12FM1 SY0AAB56YH18FM1
SY0AAB56YN03FM1 SY0AAB57YH22FM1 SY0AAB57YI07FM1
SY0AAB57YJ17FM1 SY0AAB58YK13FM1 SY0AAB59YC06FM1
SY0AAB59YD14FM1 SY0AAB60YB18FM1 SY0AAB6YD14FM1
SY0AAB6YD16FM1 SY0AAB6YI06FM1 SY0AAB6YL01FM1
SY0AAB6YN14FM1 SY0AAB9YA19FM1 SY0AAB9YC18FM1
SY0AAC10YI24FM1 SY0AAC19YG22FM1 SY0AAC19YG22RM1
SY0AAC27YF15FM1 SY0AAC27YF15RM1 SY0AAC33YL03FM1
SY0AAC34YG01FM1 SY0AAC39YA09FM1 SY0AAC41YG02FM1
SY0AAC56YA11FM1 SY0AAC56YC09FM1 SY0AAD40YK21FM1
SY0AAD43YJ17FM1 SY0AAD44YP20FM1 SY0AAD59YG04FM1
SY0AAD60YA21FM1