Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig447
Length(NT) : 1172
Best Gene Model Blast : Link to GSTUMT00011076001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Transcription].
Kog Number: KOG3561 Score: 139 E_value: 3e-09
PFAM Definition: GAL11, Transcription regulatory protein GAL11. This family contains yeast GAL11 proteins. Gal11 and Sin4 proteins are yeast global transcription factors that regulate transcription of a variety of genes, both positively and negatively. Gal11, in a major part, functions in the activation of transcription, whereas Sin4 has an opposite role, yet they are reported to be present as a complex in the so-called RNA polymerase II holoenzyme..
Pfam Number: pfam05397 Score: 122 E_value: 3e-07

Sequence:
>Contig447
TTGGGAACATGTCAGACAGCGCCGCTACCAGCCGGTCAGATCGGAGGAGC
AGCAACATAATGCTCACCCTCAGACCCAGCCTCAAAGACCTGTCACCGAG
CGCACGTCGCAGAGCAGCGACCATGTTCGTCGGAGCCAATATCAAAGCGT
CAAGGTCGAATACAGCCAGCCACAACCCCAGAAGCCCGTCGACACTCCGG
CTGAACGAAAGCCCCAGATTATCGACACCTCTAACAGAGATAGAGGAAGG
CAGTATGAGATTAGGACTGAGCCTAGTCAAGTTCAGAGACCCTCCAATCC
TTCGACTGACCGCTCTCGCCCCGCTGAACGTAAATACCAGGCGGCCATGC
CGGAGCAACAGGTCCACGCTCAAATAACTGTCAATAATAGCAACACCCAC
AGCCAGCGTCCGATCACCAAGCCAGATAACTCAAGGGTCTATCACCATGT
CTTGAAGCCCGAACAACCGAAGCAGCAACAGCAGCAACCTCAATCACAGG
CCCAACAACAGCAGCCGCAGCAGCAATCCCAAACCCTGCCGCCTCCGCCT
CCGCATCAGCACCTAAAGCCTGTCGTCTCCCACGACAGCCAGCCTGTCGT
TACGGATGAACACAAGGGTCGTCGATTCGAAGTCTCGGAGCAAGTTCAGC
AGACCGAACCTCAACGGATTGTAAATTCGTCCACAGAACGAACCATGCGT
CCGGGAGTTGAGATAGTGAGGCCACATGTTCTCGAGCCCACCAGAACCAC
CGAATCCCGTGCTCAAGAGCCAGCCCGTGTTGTGTTGGAGAACCCGAAGA
TGAAACACCTCCGCTTCGAGGCTGCGGGTAAGACTCTTACCCACAAGCAC
TCGGGTTCCAGTCTCGCAGGATCTATGGTTGTTGAGATTGGTGAGGTTGA
GAGTCAGGGGAGCGACGGTGATGAGGAAGATGACGGCGGTGATGAAGGGA
GCTGGGAGGATGAAGGTTTTGGAGAGATGGAGGAGCTCAGCAAACCCCGC
AAGCCAACTGTCCGATTTGCTGATCGCCCTTTGTCGAGGACCGGTGGTCG
TGGCATGCACATTGAGCGACCATCTTCACGTTTGGGACGACGAGTGGAGA
TTATTAGACCTTTGTCTAGGAACAGCCAGCGAGTCGAGAATGCCAGAAAG
CCCAGGATCGTTCATGCACATC

Sequences in the Contig:

SY0AAA24YD15FM2 SY0AAD20YP13FM1 SY0AAD5YI18FM1