Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4469
Length(NT) : 1332
Best Gene Model Blast : Link to GSTUMT00004186001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein BC1G_11289
Accession: ref|XP_001549819.1| Score: 1579 E_value: 1e-173
KEGG Definition: acetyl-CoA carboxylase [EC:6.3.4.14 6.4.1.2]; K01946 biotin carboxylase; K01961 acetyl-CoA carboxylase
Accession: aor:AO090011000838 Score: 1481 E_value: 1e-162
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG0368 Score: 1098 E_value: 1e-120
PFAM Definition: ACC_central, Acetyl-CoA carboxylase, central region. The region featured in this family is found in various eukaryotic acetyl-CoA carboxylases, N-terminal to the catalytic domain (pfam01039). This enzyme (EC:6.4.1.2) is involved in the synthesis of long-chain fatty acids, as it catalyses the rate-limiting step in this process..
Pfam Number: pfam08326 Score: 951 E_value: 1e-103
Swissprot: P78820|ACAC_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005774 = Cellular component: vacuolar membrane
GO:0000920 = Biological process: cell separation during cytokinesis
GO:0007059 = Biological process: chromosome segregation
GO:0000280 = Biological process: nuclear division

Sequence:
>Contig4469
TTGGGTATCACTTTCATCTGTGGTCACAAGGACGGGTCCTATCCCGGATA
CTTCACCTTCCGTGGCCCCGAATACCGCGAAGAGCAGAGTATTCGTCATA
TCGAACCTGCATTGGCTTTCCAGCTCGAACTGGGTAGGTTGTCAAACTTC
ACCATCAAGCCGGTCTTCACCGAGAACCGTAATATCCACGTCTACGAGGC
GTACGGTAAGGAGGTTCAGAGCGACAAGAGGTACTTTACTCGTGCCGTCG
TTCGTCCGGGTCGCCTGCGAGATGAGATCCCCACTGCTGATTACTTGATT
TCCGAGACCGATCGCTTGGTCAATGATATCCTCGACGCTTTGGAGATTAT
TGGAAACAACAACTCTGACCTTAACCACATCTTCATTAACTTCACCCCCG
TTTTCCCCCTCAGCCCCGAGGAGATCGAGCCTGCTCTTGGCGGGTTCATC
GAGCGTTTCGGAAGGCGTCTTTGGAGACTCCGTGTCACCGGTGCTGAGAT
CCGTATCATCTGTACCGACCCCAAGAGCGGCCTTGCGTACCCCCTTCGTG
TTATCATCCAGAACGTGTCTGGATATGTCATTCAGGTTGAGATGTACGCG
GAGCGAAAGACTGATAAGGGGCAATGGGTATTCCACAGCATCGGCACTAA
GTCTGGATCCATGCACCTTCGTGCCGTCAATACTCCATACGCTGCCAAGG
AGTGGCTGCAGCCCAAGAGGTACAAGGCGCATCTTATGGGGACCCAATAC
GTGTACGATTTTCCCGAGCTGTTCAGACAGGCTTTCCATCAGAGCTGGCT
GAAGTCCGCTAAGAAGGTTCCTTCGTTTAAGGAGAGGATCCCCCCTCTTA
CCGAGTGTTTAGAGTATAGCGAGTTGGTATTGGATGATAATGGTGGTCTC
GCCGAGGTTCAACGCGAGCCGGGAACTAACGCTCATGGTATGGTTGGTTG
GGTATTAACTGCAAAGACCCCCGAGTATCCTCGGGGACGCAAGTTCGTCA
TTATTGCCAACGATATCACCTTTAGAATCGGATCTTTCGGTCCCGCCGAA
GACAAGTTTTTCCACAAGTGGCACGGAGTTTGCGCGAAGATTGGGTATCC
CGAGAATTTACTTGTCGGCCAATTCTGGTGCTAGAATTGGCATGGCGGAG
GAGTTGATTCCGCATTTTGAGGTTGCGTGGAATGAGGCGGATAAACCGGA
GTCCGGATTCAAGTACCTTTACCTCACTCCGGAAGTCAACAAGAAGTTTG
CGGATAGGAAGACTAAGGCGGTTCTCACTGAGCGGATTGTTGAGGGGGGT
GAGGAGAGATACAAGATCACGACTATTATCGG

Sequences in the Contig:

SY0AAA44YM24FM1 SY0AAC21YN13FM1 SY0AAC33YK13FM1