Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4468
Length(NT) : 1603
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4468
TTGGGTAGGATTCACCCCGAGAATTAGTGTCAGAGGTTACAGCCTCATGG
AGTATAATAGAGACTGAGGGATAAAATAATCATCAGGTAACTTATGATAC
CGCCCTTTTTCACTCTCCTCACTCCTCAATGTCTCCGCTCTTGCACCCAG
AGCCTGGTTAGGGCCCATAATATAGAAGATTTATATTACTCAGCCAACAC
AACGTACCGGTATTCACCTCAAGATAAGTGCAACATTTTCCAAAAGCCTT
GACCAATGGTTTGTTAGCCGCCAGTCATAGCCCCGGAAGGGCTTTCACCC
GAAACAAAAAGCCTTACATTATCACACAGTAAGCTTCGGCGCATACCGGT
GCCGTAACACGAAATACCGGTATCCTACGGCACCGCACCAGTCTCGGTGC
CGATCCTTGAGCCCAGCTGTCATCCCCCGACAAGCCCAACTCGGGATGCT
CGAGTACGAGTACGATACTCGTACGGTAGGGGGTGGCGGGTATGGGAACA
TGTTCGCCGAAAAGCCAGAGATGAAAATAGAGGCGAATACTAAATTAAAG
GCATCTCAAACCGAGTGAACGTTGAGATATTCTTGGCGAGCTAACCGCAA
GCCGCATGGGACAACCCACAGCCAATGGGAGGGGCAGCCCCGTGAGTGGG
GAAACCATTCTTGGGTGCGCAATAGGGTGGTTTGGGGCACTGCACCATGA
GCTTATCTTGTGTCGATCGACCGATAAGTTAGTGGTCACGAAGCGAGTCC
AGTCATACAGCTTGCCGACTGCGGCCTAAGACCTTGGCGCACGAGACACC
CCCGGCACATGGGACGTCCCTATGAGCATATATCACACTTATTACCATCC
TCTCGTCCTCTTCCGTGGTTACTGGTGCTGAGGACATTCTAGCTTTTGTG
TTGGGATGAAACCTTCTGGAGCCGTTCGGAATGAGGATAGGGCGCAAGCT
CGGCTGATCACCCGAGAGTTAAAACGGGTATAAAGATAGCTTGCGTCATA
GTTGGGTTTTGGACGGTGGACGTTAGTAGAACCTGTGATGTTTTCGTTGC
GCATTCTCTAGCAGACATCATGGGGTTCAAGGAAGCTTGAGCAGACAATG
AAGGGATAGAGGGGATATATTATTATCGAGGCCTTTTCTCTTTGAAGGGG
GCGAGGAGAAACTTGAGTCTGTGAAGCGCGCTTGGGGAACGGAATAGAGA
GCTTTATCCACCCCGCAATACCTTCTCTCCTCCAATTCCTAATATAACAC
CGACAACATGCGATACCATACTATCCCCTCCGACACGGAGACCTATCACT
CCTACACCCGCCACCATCCTCCAGAATCTCCCCTCTACAGCATAAAACAA
GACCTCACCTGGAACAGACTGTCGAGACACTTCTTCAAGCCCGAAGATCC
CTATCCCCCGAAGCTTCGCTCTTTCCAAGAATTCAACGCGCAAAGGGTGG
AGCGAGACGTCCGTATTCGCAGATCCCGCCGAAAGCTACACTCTATGCCG
GTGTACCCGGAGTTTCACCCTGATCCCCCGGCTGTGTACCGGGAGGAATA
TATACCGCTGGAGCCGGACGGGCACGTAGAGAGCGCGTACTACTTGGGGG
CGG

Sequences in the Contig:

SY0AAA47YA13FM1 SY0AAB42YF11FM1 SY0AAC15YA04FM1
SY0AAC33YK05FM1 SY0AAD2YP17FM1