Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4466
Length(NT) : 544
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4466
TTGGCTCATTACCATACCTCTGCGCCGCTTTTTCGCCCCTGATTCCATCC
TTCTTTTCCTAATTTGTGACAGTAAGGGACGGAAAGAGGCCAGAGGGGAA
AAGGGTAGCACACACCGTGCTCACATATCCCACCATACTCAACACCCCTC
TCGTGCAGGTTCCGTCAGTATTTACATACACCTCCTTCGCTCCCATTAGA
AATACGCCCCGTCAATTCGTCCAGGCCATCGTTCTATTGCTGATTCCAAC
ACTCACGTCTTTCTACCCCCCTCATATATCTGTTGACCTCCCTTGCATTG
GTTTTGATTTCATTGCAAAAAGGGTAGTGAAGGGGAGAGGGTTGATCTCA
CTTGACTGGTAAGTTGTGAAGAAAAAAAAAAAAGAAAACAGGCGGAACAA
GAAAAGAGGGTTCGATAACATATCGGTAGTGGGGAATTCCTGTAATATCA
TAGTGTTTTTTTGTACGATACCTTTGACTATCTCAGTGGAAAAAGGAAAG
AAGGGAAGAAAGCAGCGTCACAATTTACCTCCAAAAAACTCCCT

Sequences in the Contig:

SY0AAB42YP14FM1 SY0AAC33YI02FM1