Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4465
Length(NT) : 1373
Best Gene Model Blast : Link to GSTUMT00008321001 E-value : 0.0
Numbers of ESTs : 11

Blast Results:

Nr Definition: ketol-acid reductoisomerase
Accession: ref|YP_001540985.1| Score: 358 E_value: 6e-32
KEGG Definition: ketol-acid reductoisomerase [EC:1.1.1.86]; K00053 ketol-acid reductoisomerase
Accession: cma:Cmaq_1168 Score: 358 E_value: 3e-32
KOG Definition: No Hit Found
PFAM Definition: IlvN, Acetohydroxy acid isomeroreductase, catalytic domain. Acetohydroxy acid isomeroreductase catalyses the conversion of acetohydroxy acids into dihydroxy valerates. This reaction is the second in the synthetic pathway of the essential branched side chain amino acids valine and isoleucine..
Pfam Number: pfam07991 Score: 427 E_value: 1e-42
Swissprot: A3MX05|ILVC_PYRCJ
Gene Ontology:
GO:0004455 = Molecular function: ketol-acid reductoisomerase activity
GO:0009097 = Biological process: isoleucine biosynthetic process
GO:0009099 = Biological process: valine biosynthetic process

Sequence:
>Contig4465
TTGGAGCCATACCAATCCCCCGCAAATTCGTCCTTGCGGGGTTGTGGGGC
CCATCATCGCGCCGGTACAAGTACCCTACGATACCAGCTCTCGCACGTCA
ATACCAAGATAACCGGTAATCCACAATGGCAAAAATCTACCGCCCAAACG
ACGCTTCGCTTTCACCGCTATCCTCAAAGACAATACTGTTCGCAGGATAC
GGAAACCAATCACGCTCCCAGGCTCTCAATCTCCGTGACACGTTCGCCTC
AAACCCCGACGTCTCCGCGCCAAAGATATTAATCGCCAACCGCACGGATT
CGTATCACGAGACTGCGATCGCGGATGGGTTTTCGGTGACCAGCTTCGCG
GAGGGGGCGAAAGAGGCGGATGTGGTGTTCCTGCTTGTGCCGGATCAGGT
TGCGCCTGCCCTATACAATTCAGAGATAGGGCCCAACCTGAGGACGGGTG
CGTTGGTGGTCGTAGCGAGTGGGTTTAACGTCTTTTATAAAAGGTTGGAG
GTTGAGGGTGTTGATGTTGGCATGGTTGCGCCGAGGATGATTGGTGCGGG
TGTTAGGAGTAGGTTCCTGGAAGGGGGAGGGTTTCCGTGCTTTGTTTCTG
TAGAGAATAATTTCAGTGGAAGGGCGCTGGAAATGATCTTGTCCCTTGCC
TTGGGGATAGGAGGGTTAACGGCTGGTGCTGTCGAGTGCTCTGCTCGCGA
CGAGACGCTCATGGACCTATTCGCTGAGCAAGCGGTCTGGCCGAGTATTA
TCGTCGCATTTAGAGAGGCGTATTCCACTGTTCTCCACCATTCCGCTCCC
CCTCCCCCTCCCCCTTCACCTCCCGCTTCGGCTAACCGTCATAGTTGAAA
AAACTCGGCTGCTCCGACGAAGCGCTAGTTCACGAACTCTGGCTGAGCAA
AGAGCCCGCAGAAGTATTCGAGAAATGCGCGGAGGACGGCTTCATCGCGC
AACTAAAGTACCATAGCACCGTCAGTCAGTACGGCCAACTCAGCACCAGT
CTAGGCATGGACGCTACCAAATTGCAAGAATTCTTCAAGAACGTTGCAGG
TGCGTTGGGCATTTTTAGACGGGCAACCCACTGATTTTTGGTGGCGGTGA
CTTACGATTACCTGCATGAGTTTACTTGAGCAGAGAAGCGAATTCTGGGC
GGTGAGTTTACGAAGGAGTTTATCGACATTGATAAGGAGGGGGGCGGAAA
TGGGATGGAGAGAAAGCTGGGAGGGTTATACGCAGCAGCGTCGACTTCGG
AGCTGGCGGTTGGCGAGAAAAAGGTCAGGGAGAGAATGGGATTGGACAAA
GTTTGATTAAAGCTTAATCTTCGCTGCCACGCCGAGCAAATTTATGAGTC
AACAAATTCGATGCCATCCACTC

Sequences in the Contig:

SY0AAA24YL13FM2 SY0AAA24YL13RM1 SY0AAC1YO09FM1
SY0AAC33YH20FM1 SY0AAC34YH20FM1 SY0AAC41YA06FM1
SY0AAC41YI17FM1 SY0AAD32YO06FM1 SY0AAD33YA03FM1
SY0AAD47YL12FM1 SY0AAD53YF02FM1