Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4464
Length(NT) : 1398
Best Gene Model Blast : Link to GSTUMT00005328001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: metaphase-anaphase transition protein (Mlo2), putative
Accession: ref|XP_001263064.1| Score: 782 E_value: 4e-81
KEGG Definition: metaphase-anaphase transition protein (Mlo2), putative
Accession: afm:AFUA_3G14000 Score: 767 E_value: 1e-79
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2752 Score: 359 E_value: 1e-34
PFAM Definition: zf-UBR, Putative zinc finger in N-recognin (UBR box). This region is found in E3 ubiquitin ligases that recognise N-recognins..
Pfam Number: pfam02207 Score: 116 E_value: 1e-06
Swissprot: Q09329|MLO2_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0007059 = Biological process: chromosome segregation

Sequence:
>Contig4464
TTGGTGGTAACCCACAAACAATCTTTCTATATTATTGTTAACCTTACTGT
ACTCGAGTAGTCTACTCTCACAAACAATAGACAGCTGCTCGCTGTCGGGT
GTTTTACTGCAAGCACCAACATTCAGCTCTCGCAGCGGTCGCGCCAAAAA
TTTACCGCCATGTCTTCACCCACTTCTCATAGCCCGCCGAGGGACGCTCC
AGATTCCTCTTCCCAAGACTCCGTTACGGCTCAAGACTATATAGATTCTC
AATTACAGCTCGAGCTTGACGCAAGAGAGGCAATGCCCTACTCCTTCGAC
GTTTGCACAAATCCCCTCGGTCCGCTTCGTCAGCCAGTGTTCTCCTGTAA
AACCTGTCATCCCAATACCGTTTCCGCTCCCAGCTTCACAAATATTGTTT
CCACTGGCGCAGCCGCTATCTGCTACAGTTGCTCGATCTCTTGTCATGGC
GATCACGAATTGGTCGAGATCTTCAATAAGCGAAATATTGTTTGTGATTG
CGGGACCGAAAAAATTGCGGCCGAGTGTACGCTTCGCAAGGTCAAAGGAG
AAAGGATAGATTTACCCGAGGGGAAGGTGGGAAATATGTACTGCCATAAC
TTCTGGGGGAAGTTTTGTGCTTGCGATGAGGATTACGATCCTCATAGCGA
GCGGGGCACCATGTACCAGTGTTTGCTCGGCGATGTTTGTGGGGAGGACT
GGTTCCATGATAGGTGTATTATGGGGCTGCTGAAAGTGAGCGAGGACGCT
ACAATGGATCCAGAGACTAAGGTGGTAGGAGAGGTGGGAGTGAACGGTGA
AGGTGAAGGGCAGCCAGAGGGCTATAATCATGAGGAGGCCGAGGACGACG
ACTCGCCCGAAGGATTTCCAACAGAAGAGTTCGAACACTTTATCTGTTGG
CTGTGTGTCGAAAAGAATCCTTGGTTGGGACGATACGCTGGTACCCCTGG
GTTTTTGGGTGCGGTATATAAACAAGGATTCCCACTACAAGCCAATTCAG
ACATCCAGAGCTCTGACGGGAAGAAAACTGCTAATGGTACTGGAGTTGAA
ACCAGCAACACGAAAAAGAGGAATGTTGACGATGGTGACGGAGAGGCTAT
CCGGAAGGATTTCAAGAGGGCGAAAACTCCGGAGGCCTCCAAAGTCTTGA
CCGGTTTCAATTCCAACGCGGAGCCCATATCTACTCCAACGGAGCCAGAA
GCAAAGCCGTGTAGCTACGAGACTCTTCCACCTCCGCAGCCAACCACAAA
GCCCTTTTCGATATTTCTCAAAGAAGACTTCCGTGGTTATCTATGTCGTT
GCGCCTCTTGTCTTCCACGGCTCTCGCAGCACCCTATCCTTTTGGAAGAA
GAAGAGACCTATGAGCCACCCCTTGATGATGATGATAATCAGAGTGTT

Sequences in the Contig:

SY0AAA21YH01FM1 SY0AAA28YB02FM1 SY0AAB45YG05FM1
SY0AAC33YG22FM1 SY0AAC61YL22FM1 SY0AAD46YK16FM1
SY0AAD51YP01FM1