Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4463
Length(NT) : 2417
Best Gene Model Blast : Link to GSTUMT00006699001 E-value : 0.0
Numbers of ESTs : 11

Blast Results:

Nr Definition: hypothetical protein BC1G_13370
Accession: ref|XP_001548180.1| Score: 1678 E_value: 0.0
KEGG Definition: predicted protein
Accession: aor:AO090012000511 Score: 1597 E_value: 1e-175
KOG Definition: No Hit Found
PFAM Definition: OPT, OPT oligopeptide transporter protein. The OPT family of oligopeptide transporters is distinct from the ABC pfam00005 and PTR pfam00854 transporter families. OPT transporters were first recognised in fungi (Candida albicans and Schizosaccharomyces pombe), but this alignment also includes orthologues from Arabidopsis thaliana. OPT transporters are thought to have 12-14 transmembrane domains and contain the following motif: SPYxEVRxxVxxxDDP..
Pfam Number: pfam03169 Score: 979 E_value: 1e-106
Swissprot: P53134|YGL4_YEAST

Sequence:
>Contig4463
TTGGACCCTCCACTCTTTTCCATCTCCAGCATTGTGCAACATGTTGTCCA
TGGCGCATTCGTCTACGGTAGCTCAGGTTTGATTTCTAACTTGATGGCCA
ATTCTCCTCCCCTCCTTCTTTTGCTTCCTCTAGGCTGGTTCAACCTTCTC
ACTTTCGACCGCCTCCATCACTTCCCCTAGTGCCCCTAATGCTTTCTTAT
TGCCAGGGCAGCGGCGGCTCTACTGCTGGGCGGGGGTACGTGGCGGGCCA
GGCTGCTGAGAGGCAATTCACCCTGCGCGCGGTCGCGGTGGGTTTGCTTG
TTGGGACGGTGGTGAATTTTTCCAATATGTACTTTGGATTGCAAACGGGA
TGGGTATCCATGATGTCGATGCCTTCTTCACTGATTGGCTTCGCGATATT
CAAGAGCTGCGCGAAGCACTTGGAGTTTCCGTTTACTCCTGTTGAGAATG
TCCTTGTACAAACCGTAGCAGGAGCCGTGGGCTCAATGCCCCTCTCCGCG
GGCTTCGTTGGTGTTGTTCCCGCTCTCGAAAAATTACTCAAACCCGAGGA
AGGGGGTCCGCTAAGAATCGGTACACCACAATTGATGTTCTGGAGTATTG
GCGTAGCGTTCTTTGGGGTTTTTTTCGCCGTGCCATTGCGAAGGCAGGTT
ATTATCAGAGAGAAATTGAAATTCCCAAGTGGGACTGCGACGGCATTGAT
GATTTCTGTTTTGCACGGGAGTGGAAAGGTGGCTGCTAGGGGAGGTAGTG
GAGACGAGCGAGAGGGATTGGTTTCTGGCATGGATGAGGAAGAAGAGCGG
GAGGGGGGTCGGGAAGTGCAGGAGGATGCAGGAAGGAAGGAGAGCTGGGG
ACAGAAAAATAGGTTATTGGTTTATTCTTTTGCACTTAGCGGGACTTGTA
CATTCATCTCTTACTTTTTCCCCATTCTCCGGGACCTCCCGATCTTCGGC
TCCGCCGCCGCAAGCACCTGGCTCTGGACACTAAACCCTAGCCCGGCATA
CGTAGGCCAGGGCATAATCATGGGGACGGGCACAACGTTGCACATGCTTC
TCGGGGCGATAATCGGCTGGGGTGTACTCTCCCCGTTCGCAAGATATAAA
GAATGGGCCCCTGGCCCAGTGAGTGACTGGACTACCGGCAGTCGTGGATG
GCTTGTATGGGTTAGTTTGGGTATTATGTTGAGCGACAGCGTGATCTCCC
TTGGTGGTTTGATCCTAGAACCAATTATCAAGTCTCTTTGGCGGCGGTGC
AAGAAGGTGTCCAGGGGCAGGGAGGGGTACGAGAGACTTATGGACGGCGG
TGGCGGGAGTGAGTATGAGGAAGGAGACGAGGCTTGGGGACTTTGCAGAC
GGAGAAGCGGGAGGTCGGGGGTGGGTGAACAAGGCGGTGAATCGCCTGGG
GAGGATGCTCCGGATGAGCACCTCGTCCCAATGAAAACCGTAATAATAGG
CCTCCTAGCATCTGGCCTGCTCTGCATAATCGCTGTAGAAGTCGTTTTCA
GCATGGTTCCTCTCTACGCCACCGCAATAGCCTTCCTCCTGGCATTAATC
CTTAGTGAAATGGGTGTCCGCGCACTCGGCCAAACAGACCTAAACCCCGT
CTCGGGCATCTCAAAACTCACCCAACTCTTCTTTGCCCTGATAACCCCAC
CCAGCCATCCCTCCTCAATAATCACCAACCTAGTGGCGGGCGCCATCTCA
GAAGCTGGCGCCCAACAAGCCGGCGACATAATGCAAGACCTAAAAACCGG
CCACCTCCTCAGCGCCTCCCCTCGGGCACAATTCCACGGCCAACTCATCG
GCTCCGCATTCGGCGCCATCATTTCCGCTGGCGTGTATCGTCTATACACA
TCCGTGTACCCGGTCCCTGGCAAGCTATTCCAAATCCCCACGGCGTACGT
GTGGATCGACTGCTCGAGACTGGTGTTCGGACAGGGACTGCCGGAGGGTG
CAAGGGGGTTTGCGGTGGGCTTTGCGGTGTTGTTCGCGGTGATTACTGCA
TTGAGGGGGTGGGCCACGTTGGGGAAGGGGAGGTGGGCGGGGTACTTGCC
CGGAGGAATTGCGGTGGCTGTGGGCATGTATAACGTTCCGAGTTTCACCC
TGGCTAGGGCTTTTGGCGGGCTTGTGCAATGGTGGTTCGGTGGACGGGGG
CAAGACGCAGAGGCTGGATTGGTGGTTTTTGCTTCGGGATTGGTCTTGGG
TGAAGGGGTTGTCAGTATTGTGAACTTGGGCATGGCGAGTTTTGGGGTGC
CGCATTTCTGATATGGGGTTTTTTTTGTACTGTACTGTACTGTACTTGAC
TGGAGACTAGATTGGTTGGGTTTTCATTGTAGTTTCCTAGCCTTTATTTT
CATTCCAGCTTTTCGGATAGTCTCGGCATTTCCAGAATCATACCTAATGA
CGCATAATCTCTATTAC

Sequences in the Contig:

SY0AAB44YA04FM1 SY0AAB44YN22FM1 SY0AAC2YH23FM1
SY0AAC32YN07RM1 SY0AAC33YG17FM1 SY0AAC34YL02FM1
SY0AAC46YD16FM1 SY0AAC8YK15FM1 SY0AAD26YG08FM1
SY0AAD33YC24FM1 SY0AAD50YD16FM1