Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4462
Length(NT) : 1766
Best Gene Model Blast : Link to GSTUMT00009853001 E-value : 0.0
Numbers of ESTs : 23

Blast Results:

Nr Definition: hypothetical protein SS1G_07495
Accession: ref|XP_001592047.1| Score: 491 E_value: 3e-47
KEGG Definition: transformer-SR ribonucleoprotein, putative
Accession: afm:AFUA_7G05260 Score: 487 E_value: 4e-47
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG4207 Score: 241 E_value: 7e-21
PFAM Definition: RRM_1, RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain). The RRM motif is probably diagnostic of an RNA binding protein. RRMs are found in a variety of RNA binding proteins, including various hnRNP proteins, proteins implicated in regulation of alternative splicing, and protein components of snRNPs. The motif also appears in a few single stranded DNA binding proteins. The RRM structure consists of four strands and two helices arranged in an alpha/beta sandwich, with a third helix present during RNA binding in some cases The C-terminal beta strand (4th strand) and final helix are hard to align and have been omitted in the SEED alignment The LA proteins have a N terminus rrm which is included in the seed. There is a second region towards the C terminus that has some features of a rrm but does not appear to have the important structural core of a rrm. The LA proteins are one of the main autoantigens in Systemic lupus erythematosus (SLE), an autoimmune disease..
Pfam Number: pfam00076 Score: 182 E_value: 4e-14
Swissprot: Q10422|YDC1_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig4462
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTTCCATCCTTCCTTTCTAT
TTCTCCAACGCATTCTGCTTTCCCAATCCTTTCCCTCGTCATATTTCATC
AGCCTCACTTCCTCCTTCTCCCTCTTAACTTCCCTAGTCTCCCAACACAA
CATACCTCTTCGTCCCCCTTCGCTCTGCTCTCTTGTGTTTGATCGTGTCA
CCTTGAGCGATTTCACCCTGTTTACTTTCTTCGCCTTGTGCTACCCAACA
ATACTATTTTGTTTTTTGAGTTTTGAGTACGGTTTTAATGACGATGGACT
ATGAAAATGAAAATAACCGTGATTACGATGAAGATGGACGTGACTACCGT
CGTGATGAACGCTCGATGTCGCCTCGTGGACGTCGCGAGGATTCTTCCCC
AAGAAGGGACCGCGTGAGAAGCGCCTCCCCTGGGGGCCGTGGCGGCGAGA
GATCTGTTCCTCCTGAGTCGCGCCCTGATGATCGTCGCCCTATGGATACT
GCCTCCACCTCTTCCGAGCGTGGTGGTGAACGCCGTGGTCCTAGCTCTTC
TGATGGCTCCCAAAATCCTGGCACTAACCTCTTTGTTACTGGCATTCACC
CACGTCTTACCGAAGATGATGTTACTCGTCTCTTCGCCAAGTACGGTGAG
GTTGAAAAGTGTCAAATTATGTTGGACCCTCACACCAAGGAGTCTCGTGG
CTTCGGGTTTGTCAAGCTTGCTACATTGGATCAAGCGGACAGCGCGAAAG
AGCATTTGCAGGGTGAGGTTTTTGAAGGCCGAACTTTATCTATTGAGAAG
GCGAGACGTAGTCGTCCCAGGACTCCTACTCCTGGAAAGTACTTCGGTCC
ACCTAAAAGAGATGATTACCGTCGTGGGCCACCCGGTCGTGATGATGGTG
GTTACCGTGGTGGGCGTGGCCCGTCGCGTGGTGGTGGTGGCCGTTTTTAC
GATGATTATGATCGTGGCTATAATCCTCGCTATGATGATCGTGATCGTGG
CGGGCGTGGAGACCGCTACTATAGTTCTCGTGATAGGGGTGATGACTTCC
CGCCCCGTGGAGTTGACCGCTACGCGTCTGGACGTGACGATAGGTATAGT
GGAAGAGATGAAAGACGTGCGCCCAGGGATGCTGGCTATGCTAGCTATAG
TGATCGTGATGTCGGATATTCTCGCAGCAGTGCTGGTGAGCCTGCGGTTC
CCGCAGCCACCGGCGGCGAAGGTGGAAGAGCCTATGGAGGTGGCGCTTAC
CGTGACGAGACCCGTGGCGATGATCGTAGTTACAGGAGATAGATTATTCA
GGCCTATCTAAAGTCACCCACCCTGTAGTTTTTTCTCTCTCTTTTTTTCC
TTTTTTTGATCGGGTACAGCTTTCTCCCTTAACCTTTATTTACACTTTCT
AAAAGTCTATCTTTGTATCCCTTCATTTCTTACTTTGTTCCTTATCGTGT
GTGTTGTTTTGTTTTCTTTGGTTGGAGAGTCGGGTCTTGTGTTGGAAGAG
GAGACTTACTTCCTCTTCTCATGCGTCTTTAGACTCGGATTAATTCGGCG
GTCGGAAAAAAATTGGGGCAGGGAGGAGGATCTGTGTGAACGAGTTCGAC
ATCAACGAGCGACAAGTGATTTTGACAGTTCACACTGGCTCGGTCTTTCG
TCGATACTTCTCAAAATTCTTCTTTTTTCTTTTCATGGAGCGGCCTATTT
GCAACACCGGTCAACTATTCAGATTACAAATATATAAAAAAGCATCGCGA
CCGCTAGTTGGAAACG

Sequences in the Contig:

SY0AAA21YP23FM1 SY0AAA24YA19FM2 SY0AAA26YK19FM1
SY0AAA28YL22FM1 SY0AAA37YD22FM1 SY0AAA40YK24FM1
SY0AAA49YH24FM1 SY0AAA53YN11FM1 SY0AAA5YM10FM1
SY0AAA8YA04FM1 SY0AAB17YJ11FM1 SY0AAB17YP18FM1
SY0AAB18YO20FM1 SY0AAB22YF10FM1 SY0AAB29YB20FM1
SY0AAB41YG01FM1 SY0AAB50YO04FM1 SY0AAC10YB06FM1
SY0AAC15YD09FM1 SY0AAC33YG09FM1 SY0AAC36YI24FM1
SY0AAC47YD13FM1 SY0AAD46YE04FM1