Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4461
Length(NT) : 1329
Best Gene Model Blast : Link to GSTUMT00011973001 E-value : 1e-146
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4461
TTGGCAGTTTTTCATAGCCCTCATGTACCGGTACTCGTATCGTTCACACT
GTTCGTTCACTCACTATTTTATTTTTATTTTTTCCTTTCTCGTCCCCTGC
CTTTCCTCTTCTCTCCCATCATGTCCTCACCCCCCCTCCTTATTTTTCTC
GCTACCAGCATCTCCCTCTTTTTTCCCACTCTGCTGTCTCAAACTGGATT
GATTCTGAATGATGATCAGTACCAGAATAGAGGAAAAATAAGGGGTGGGT
GAAAAATCTGTTATTGTGAGTATTTGCTGATGAAGAAATTTCTTTTCTTT
TTTTCTTTTTTCTTTCCTTTTTCCTTTTTTTTTTTCGTGTGTCAGGAGAG
CCGAACTTCAGGATCCGAGGGTTTTTGTTACGAGGATCTAGTGGTATTTG
AGGACAAGCTCATGACGGCAGAGGTTGGGAAAACTCATGAAACTCTGACA
GTTAGCCGGTAACCGCACAATTCAGGCTGAACCTACCGCTCGCTGAGTAT
CCTTTATCAGATCTAAGGCTCAGTTCCACCAATTAGATAATTTTTCTAAG
GGTCTAGTCCTCTCAACCAACCAAAGCCTCACGCTACTATCCTCCGACCC
ATCCATCCATCAATTTAAACTTCAACCCCCATCTCTCCAAGCTCACCTGC
AATATCCCTGTCCTTTTATTGGGAAAACAACTCCCATACTTATGCCTTCG
AAAGACGAAGATGCTGAATTTGCAAAGGCCTACAGGGACCTGATGGAAGC
TGAGAAACATGCAGCTACCCTGGAAAACCAGTTGAATTCGCTCGAGCACA
AATTGGACTCGTTTCTAGCTGAGCATGAGGGCAAACATCCTGAATCCGAC
AACACTAATGCTTCGGGAAGCATTAGTGGTGGTGCATTTGGGACAGGGGT
AAATGCTCCGCAAGGTGGTGATGTGGAGAAAGCTCCGAAGGATTCTCAAT
GAGCGTGTGTAATGGTTTTTGGCGGGCGGGAATGGTAGTAACATTGTTTG
CGGAGCTTGGATAAGCCAGGTTATCATTTCGTGCTTAGTGATTATCGCTT
ATCGAGGGAATGTGGTGGAGTGGATTGTTGCCCAGGTCTACTCGAACCGT
GCCGGATATTAAAATATAGCACGGCCTGTTGATGTCATGACTTTTGTACG
TACCGGACTATCTTTTGGTACTGCCCCAGTGGATCACTTTTCATAACAAG
CTCCGGTTCCTGACAACAGCCCATTGGGTATTTCAGGGGAGAACCCCTCC
TTCGCGCATACTCTGGGTGTGCAAATCAGCTCGGCACAAACCCCCTGACC
ATTCACAGTGGATACCGTACAACTATTCA

Sequences in the Contig:

SY0AAA22YD15FM1 SY0AAA6YN09FM1 SY0AAB56YP02FM1
SY0AAC33YG05FM1 SY0AAC46YC06FM1