Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4460
Length(NT) : 817
Best Gene Model Blast : Link to GSTUMT00004391001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE65796.1| Score: 382 E_value: 1e-46
KEGG Definition: predicted flavoprotein involved in K+ transport
Accession: aor:AO090103000361 Score: 382 E_value: 6e-47
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG1399 Score: 121 E_value: 2e-07
PFAM Definition: FMO-like, Flavin-binding monooxygenase-like. This family includes FMO proteins and cyclohexanone monooxygenase..
Pfam Number: pfam00743 Score: 116 E_value: 8e-07
Swissprot: Q00730|STCW_EMENI

Sequence:
>Contig4460
TTGGGGTGATACCCTACAGTCTTCTTCATATCGAAGTCTTCATTTGCGAG
CCTCACTATCTCTCCATAATGGCCCCACCTCATGTCGATGATCAGTACTC
TGCGGGCTCCACCTACCCACCAAACTGGATTCCAGTTGTGGAGAAACCCC
TACGCACCCCGAAACGAGTGAGAATTATTACTGTAGGTGCTGGGCATTCC
GGATTAATGCTTACGTACAAGATTAGAAACCAGTTCAAGTACGGGGACTT
TATGGACCACATTATCTATGAGAAAAACGTAAGCTCCCCGAAGTCGCCAT
TCACAGTTATCTGATTTCCACAGCATGATATTGGCGGAACGTGGCTTGAG
AACAGATACCCAGGTACATCCCCAAGATTAATATCCCCCATCCCCCCAGC
GGGACACTTTCTAAGCCCTTTTTTTTCGACTAGGGGTTGCCTGTGATGTT
CCTGCTCATATATACACCTTCTCATGGGAGCCAAATCCGGACTGGAGCGA
GTTTTACGTTGGCGGAGAAGAAATTTTCCAATACATGAAGCGTACAACGG
CGAAATACGACCTTGCAAGAGATGTTGTTTTCAATTCCAAGGTTGTGGAA
GCCATCTGGGACCAGGGGCGAGGTAAATGGGAGCTCAAGATTGAGCAAGA
GGGACGATTTATCTGGGACGAATGCGATATCTTTATAAACGCCTCAGGGA
TCCTGAATAAATGGAAGTTACCATCCATTGAAGGAATAAACGCTTTCAAG
GGACACTTGGTGCATAGTGCGAAATGGGAGGATACTTACGACTTTGCTGG
AAAGAGAGTTGGAATTA

Sequences in the Contig:

SY0AAC33YE04FM1 SY0AAC41YK24FM1 SY0AAC47YK10FM1
SY0AAD14YF23FM1 SY0AAD21YA03FM1 SY0AAD21YJ13FM1
SY0AAD24YG06FM1 SY0AAD24YJ22FM1 SY0AAD27YP19FM1