Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig446
Length(NT) : 660
Best Gene Model Blast : Link to GSTUMT00008676001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001543717.1| Score: 470 E_value: 2e-45
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig446
TTGGCCAAGACTAACGATGTCTCAAAATCGCTCTCTGGGACGCAATGTCT
CATTTTGCGACGCTACGCAACCTGACATTGCCCTTGGAGGGCTTATCCAG
AATGGGTCTATAACCGAGGCAAACTTTCTTGACATTCTCGCAATCGTACT
TGTTGTTGAGGGGGGTTCTTTACGCGTCCAAGCGAGGGTATCGGGACACA
TCGTATGCAGAACAGACGTTCCTCTTAAAAGTGGAGTTTACGATATTTAT
TCTGATGCCTCTGTCCAAGTCAGCGATGAGCCCTGGATGCCACGGTTGGT
TTACCATGATACCCCCTGGAGAGAGGACCGTTTCACCAATTGTATCCGCA
ATCGTGACCGGAAATGTGTAATTTTAGGAATCTCAAATCCTGAAATTCAT
ATCCAGGCCAACAACTGGACCATTTTTGAGGCTGCCCATATCTTCCCCCC
TGAGCATGAAACTCTTTGGACTCAGGATAATTATGGACGATGGATCACTG
ATATGGACAGGGCTACCGAATCTGCAAAGATCTACTCAATTCAAAACGGG
TTTCTTCTACAGTCAGCTCTCCGGACACTATTCGATGCGTACCTCATTTC
CATCAACCCTGATGATGGTTACAAGGTAGTTGTGTTTGACAGTGACATTT
TCGGCTGTGA

Sequences in the Contig:

SY0AAA24YD13FM1 SY0AAA24YD13FM2