Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4459
Length(NT) : 769
Best Gene Model Blast : Link to GSTUMT00003874001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4459
TTGGCACAAATTCTCTCCAATCTTCCTCACCTCCCCCTTTTCTGTTCGCG
CCACCCGGTTTGTTTTCTCGCTTCTCTAATCGCCACCCCCCCTTCACACT
TATTTTCATCACGGAGTTTGGTTTCTTACGGAATCCTCACCTGTCCGTTT
GTTGTTCCCTGGGTCGATTTCAGCCCTATCCGCTCTTTTATTCTTCAACA
TCGGACGCATTTGATTGTCGTCCCCATAACAAGGCTTTCGCAGTCCACAC
GCACTAGCTTCTATTCTCGTCTTATTTGGCATTTCAATCATCACGGAATT
ATTTGTCTTGAATGGTCTTGTAATTCGTTCCCTCTCGCTTCTTTGGTTGT
AGTTGCCTTCCTCTTCTAGAGGTTCGGTCGCGCCTCGTATCTCTCAATCA
TGAGCAACGCGACAGCTACCACTCCTAGTCCCAGTCCCCCCCCTAATCCC
CCTCAGACTACCCTCGCTCCAACCACGCACATAGATACAATTATCACTAC
AGCCTCTGCCTCCTCACGGAGGGTCACAACTACCGTTATAACCTCTACCT
CAGTTCCGTCGGCAACAGCATCAGCGCCACACTCAAAGATCTCGCGACCG
TCGTCTACAGGCTCATTGACATCCAGTTCGAGTTCTGCTTCCGACACATC
TCCAACAGCTGCTGTCACGGGTGGTGGGAGGAGTGGTGGCGGACTAAATG
GAACCACAAGGGTTGTTGTGGCGGTTGTGGTTCCGATAATTGGTGTCGCG
TTAATCGCGATTGGATTGT

Sequences in the Contig:

SY0AAA17YC21FM1 SY0AAA22YG07FM1 SY0AAC16YP03FM1
SY0AAC29YG03FM1 SY0AAC33YD20FM1