Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4458
Length(NT) : 653
Best Gene Model Blast : Link to GSTUMT00005691001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein CIMG_01796
Accession: ref|XP_001248025.1| Score: 674 E_value: 4e-69
KEGG Definition: AAA+-type ATPase containing the peptidase M41 domain [EC:3.4.24.-]; K08956 AFG3 family protein
Accession: aor:AO090026000613 Score: 650 E_value: 1e-66
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0731 Score: 403 E_value: 3e-40
PFAM Definition: FtsH_ext, FtsH Extracellular. This domain is found in the FtsH family of proteins. FtsH is the only membrane-bound ATP-dependent protease universally conserved in prokaryotes. It only efficiently degrades proteins that have a low thermodynamic stability - e.g. it lacks robust unfoldase activity. This feature may be key and implies that this could be a criterion for degrading a protein. In Oenococcus oeni FtsH is involved in protection against environmental stress, and shows increased expression under heat or osmotic stress. These two lines of evidence suggest that it is a fundamental prokaryotic self-protection mechanism that checks if proteins are correctly folded (personal obs: Yeats C). The precise function of this N-terminal region is unclear..
Pfam Number: pfam06480 Score: 294 E_value: 1e-27
Swissprot: Q9HGM3|RCA1_SCHPO
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>Contig4458
TTGGGGGAAGAAGGAGGGTGCTGGTGGCGCCGGCTCGGGCTCGAATACAA
ACTCTTTTAAATTGGATACCACTTCTTTAATAGTCTCATCCATCCTTTCT
TACATGCTTTACCGGATGATCCCGGGAGAGCAGTCGAGGGAGATCACCTG
GCAGGAGTTCCGGAACACTTTCTTCGATAAGGGGCTTGTGGAGAAGTTGA
CTGTGGTCAACCGGAGCCGAGTGAAGGTCAATCTGTACAGAGACGCTACC
GCCCAGATGTACCCTGATTCCCCGGCTGCCAATGGGAACTTCTACTACTA
TTTCAGCATTGGGTCGGTGGAGGCTTTCGAGCGAAGATTGGATGACGCTC
AGAAAGAATTGGGAATTCCTAGTTCCGAACGGATACCAGTTGCTTATAGG
GATGAGATTTCTTGGACCGGAACCGTGCTTTCTTTTGCCCCCACCTTGTT
GGTAATAGGCTCAATCTTCTGGCTGTCACGGCGTGCTTCGAGTGGAGGCG
GGCAAAGTGGGATTTTCGGCATTGGGAAATCCCGGGCCAAACTCTTCAAT
CACGAGACAGATATCAGAATAAAATTTAAGGATGTTGCCGGTATGGACGA
AGCAAAGGTCGAAATCATGGAGTTCGTTTCGTTCCTGAAACAGCCTGAAC
GCT

Sequences in the Contig:

SY0AAA47YA12FM1 SY0AAC33YD14FM1 SY0AAC40YE22FM1