Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4456
Length(NT) : 1033
Best Gene Model Blast : Link to GSTUMT00004884001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein AN0812.2
Accession: ref|XP_658416.1| Score: 197 E_value: 2e-13
KEGG Definition: hypothetical protein
Accession: ani:AN5956.2 Score: 197 E_value: 9e-14
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4456
TTGGGTACTTTCTCTCGAATACATGTTACAAAGCACTCAAATCGAGGAAA
AAATTCTCTACCCTACGGTAGTCCACCGGTAGGGACGTTGTAATTGCCCC
TGGTTAAGGCGGAGCCCCTGTACTGTATTTTTTTTCTCTTTTTCTCGTTT
CTCGTTTCTCTTTTCAAACTGCGTAAAATGCGGGTCGGCGAGGATGAGTT
AGTAGGGCTCAGGGCATGTCGGAGAGACGTTATTAAAGCATCCTATGATA
CGACACCCGATTGGTCTAGAGAAAGGGAAAAGGAGTTATCATTTCACTTG
CTGGAAAAAACTCGAATATCATACCGGTGGGTGATGATTTACGAATGTGC
CAACTGGTATGATACTGTATCGATAGGACGTTGTACAGTACAGTACGAGG
CTGTGGACAAAAATCACCGCTAAGAATTGTGCATCGCAACCGCAACCATC
GTACCCACGATAGTGAAAAAATGACCTCAACTCCACCACGAAAGCCACCC
CATGGTGAATGGCATACACCAATGCGAAGCAGAGTTCTTGCCTTGCTCTC
CACTGGCTTGACTCAGTCCGAAGTTTCACAACAAACCGGTGTACCACAGC
AGACAATAAGTGATTGGAAAAGGTTACAACAGCCTCGAAGGAGACGAGAT
CGATATGGACAACCACACCTCCTCAGCAAGCATGATATCCGCCGCTTGAT
CGCCCGTCTGCGGAGTGGCTGGGAGGGGCGACACCTTTGCTGGCGAAAGT
TGGAACAAGAGGTGGGATTAACTGCTTCTTCTAAGACAATTAAGCAAGCG
CTTGGGAAGGAGGGATACACAAGGTGTAAGGCTTGCAAGAAGCCGTTTAT
CAATCGGATAAACCAGCAGAAGCAGAAAGCCTATGCTGAGGAACATATGC
TTAAACCAATTGATTGGTGGCGCAAGCATATGTTCTCTGATGAGTGTATC
TTTGATACATCTCAACGTGGTAGTATTTGGGTTACATGGCTTCCTGGGGA
GCGCTACCATGATGATTGTATGCAACATACTTT

Sequences in the Contig:

SY0AAA13YG08FM1 SY0AAC33YB21FM1 SY0AAD40YK16FM1