Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4455
Length(NT) : 835
Best Gene Model Blast : Link to GSTUMT00005461001 E-value : 0.0
Numbers of ESTs : 16

Blast Results:

Nr Definition: hypothetical protein BC1G_12042
Accession: ref|XP_001549501.1| Score: 462 E_value: 2e-44
KEGG Definition: hypothetical protein
Accession: fgr:FG10050.1 Score: 438 E_value: 7e-42
KOG Definition: No Hit Found
PFAM Definition: CsbD, CsbD-like. CsbD is a bacterial general stress response protein. It's expression is mediated by sigma-B, an alternative sigma factor. The role of CsbD in stress response is unclear..
Pfam Number: pfam05532 Score: 124 E_value: 9e-08
Swissprot: Q6N1I7|Y4418_RHOPA

Sequence:
>Contig4455
TTGGGATGGATCCCACTAGAGGCCTCCTCGTCAACATGCACATTGTCACA
CTTGACTTCCTCAAAAAAAACACCATTTTGCCCACCCTCAATACTCTCTC
TTCAAGGAAACAAATAAACAAACATTCCGAATGTCTGGAACTGGAGATAG
CCAACCCTCCACTCTTAGGTCCTACGCCGACAGCGGCATTGCGGCTGTTC
AGAATGTCATTGGCAGTTTGACTGGGAACCCTGTTGATCAACGCCAGGCT
GAAGACAAGAAGGCCCATGCAGAGCTAGAACATGATGCCTCTCGTGCCGC
CGCCAAGGCTGGACCTTTCAATCTTTCCTCCTCCGGCGCAGCCACTGTCG
ACAACAAGGACCGCCGAGACGGAAAGGCCGACCAAGTCATTGGAAGCGGC
AAGGAATTTGTCGGCAATGTCGTGGGATCCGATAGCCTTAAACGTGAGGG
CAGGGATCAAAATACCGAGGGCCAAGGGCAGGAGGCTGCCGGACAACTAA
AAGATTTTACTTCGGGAGTTGCCAACAGAGTTACCGGCACCATTGGGGCC
GCTGTTTCCGGTCTGACTGGCAATACCCAGGCAAAATCTGACTTTGAAAA
CCAACATGATAAAGGAAAGACTTCCCAGCGCGGCGTCGAAGCTGAGGTAC
AGAAATAATCGCAAAACATCAATTGCCAATGATGATCTAGAAGATAATCA
TATGCAACGGCGTTTATGGGTTCTTTTTTCTTTGGGGTCGGAGGCCGACT
TTACTTGCTTCACTCAATACACCGACTGTTGCGATTAGCTGTAAAATTAG
TTAGCTCGCATTCAACAATGATCCCTTGCATCTGG

Sequences in the Contig:

SY0AAA42YO02FM1 SY0AAB24YN13FM1 SY0AAC12YP18FM1
SY0AAC22YN04FM1 SY0AAC24YA05FM1 SY0AAC27YG04FM1
SY0AAC27YG04RM1 SY0AAC33YB20FM1 SY0AAC58YP09FM1
SY0AAD32YK02FM1 SY0AAD32YK14FM1 SY0AAD35YN22FM1
SY0AAD43YH12FM1 SY0AAD57YF16FM1 SY0AAD63YG05FM1
SY0AAD6YB19FM1