Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4454
Length(NT) : 1018
Best Gene Model Blast : Link to GSTUMT00003648001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein SNOG_11118
Accession: ref|XP_001801367.1| Score: 715 E_value: 2e-73
KEGG Definition: predicted protein
Accession: aor:AO090020000593 Score: 706 E_value: 8e-73
KOG Definition: No Hit Found
PFAM Definition: DUF1688, Protein of unknown function (DUF1688). A family of uncharacterised fungal proteins..
Pfam Number: pfam07958 Score: 599 E_value: 1e-62
Swissprot: Q9US42|URG3_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig4454
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCGTGGGTTGTTTGCAGCG
TATCCCCTGAACCCCTACCCTGTCACCCTGCACTTTGACCCGTTTTCTTT
GGTCCGCTGCTGCTCGCTCCCTTCCTCTCCCACTCTGCGCGCTCTCCATC
CACAGACACACATCGTTCTCCCTCCCTAGAGAGTCCTTCATCACCCCCTC
CTTTATCTTCACCTTTCCTCAGCTCGTATCGGCCTGCACTTTTCCGAATT
CTTATTCCCGTCGCCAATTGATTTCTCGGGGTCATGGGTATATTTTCCAA
AAAATCGAGCTCTAGGGCAAATTCTGTCACTTCAGAGAGCACTTGCAAGT
CGAATCGTAAGGGTTCTCAAACCTCCCTTGCGAGCACTCCCAAACCTCCT
TTTACCGGTAAACAAGGCAGATCCTCTTCCTCTGGAAACACTTCACCAGC
TTTGCCTTCCATTCCATCCATTGAACTAGCACCTGCGCCAGATCCAGGAT
TAGATCCCTCCGGTTATCTCAGAAGCATTTATGCCGTTAGAGAGCGTTCC
AAGTTTGTTATCGAGGCAGCACTAAGAAATCAGCTCACCAACTTCACTGT
TGACATGACCAAGTTTAAGGATGTTGCCGAATACGTCGTCTCCATAATAA
AGAGAGACTATGCTCCCGATTATCACACGATTCCTCCTCACGGTCGGTGG
CAGCATTTTGAAGTCGGCGGTCGCCCTCGCATTGACGTAATGATGCAATC
CTGGCCTTCTGACCCCGCGGAGCAAACTAGGAGGCTTATTGATTTGTTCT
TGGTTTCTGTCCTGCTCGATGCCGGCGCCGGGACAAAGTGGCAATATAAG
TCGAAGGATAATGGCAAAGTTTATCGTAGGAGCGAGGGTCTGGCGGTTGC
TAGCTTGGACATGTTCAAGGAGGGCTTATTCTCAAGCAATCCCGAGCAGA
AAGAACAAGTGGACGGCATGGCATTGAAAAACTTGACTGTACAGGTTTTG
GCTGAGGCCCTCCAGGTT

Sequences in the Contig:

SY0AAA11YE16FM1 SY0AAA63YB22FM1 SY0AAC33YB19FM1
SY0AAC39YH20FM1 SY0AAD15YK21FM1 SY0AAD42YG09FM1
SY0AAD43YJ05FM1