Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4453
Length(NT) : 1304
Best Gene Model Blast : Link to GSTUMT00002953001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: NADH-ubiquinone oxidoreductase 64 kDa subunit, putative
Accession: ref|XP_001272658.1| Score: 953 E_value: 1e-101
KEGG Definition: hypothetical protein
Accession: ang:An11g09350 Score: 946 E_value: 1e-100
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG2495 Score: 548 E_value: 1e-56
PFAM Definition: Pyr_redox_2, Pyridine nucleotide-disulphide oxidoreductase. This family includes both class I and class II oxidoreductases and also NADH oxidases and peroxidases. This domain is actually a small NADH binding domain within a larger FAD binding domain..
Pfam Number: pfam07992 Score: 142 E_value: 1e-09
Swissprot: P40215|NDH1_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion
GO:0003954 = Molecular function: NADH dehydrogenase activity
GO:0005515 = Molecular function: protein binding
GO:0001300 = Biological process: chronological cell aging
GO:0019655 = Biological process: glucose catabolic process to ethanol
GO:0006116 = Biological process: NADH oxidation

Sequence:
>Contig4453
TTGGAGAAATTGTGCCCTTTTGCCTCCACCTCCCTCCTTCCCTCCTTCCC
TCCCTATTCAATTCCTCAGCTAACTCTCTGTATCATACCCCTCTCGTCCT
TCATTTCGTTTTTACTATTGCTTTGCTCTCCACACGCCCGTCTACCCCCT
CTTCCAATCCCCCCCCCCTCACTGCCTCGGATTTGCCTATCCACCAGCAG
CTTCCATCCTCCGAGCTCATTCATTCTTATCCTCTGCCTTGAATTAGCTA
GCCATACCCCCGATCACTAGCCCCCAACACCTACATAGCCATGCTCCGGC
AGAGAGTCCTCTCGAGTTTTCACACAAACCCACTTACCCGCCAAATCTTC
AAGCCATCGCCCCTCCTCCGCACCCTTCAAAAACTAAATACCCGGCGCGC
GTCACCATCCCCATTATCCAATGCCTCGTTAAGAACCATCCCCGCACGGA
GCAGCCCTCTACCCACACCGCATTCCCGGGCATCGGCAACGATAGCCCCC
TCCAATGGCTCAAAAACACCTAAACGCAGTAAAGTAGTAAGATTTGTCTA
CAAAGCCTCGGCATTCTGTGGGTTTGCCGGGTTGACGGCGACGGGATTGG
TTGTCGCATTTTTCATTTACGATGCTAGCACTTATAAAGAGGAGGCGGAG
AAGTACGACATTGGAGTATCAGAATTGGCGTTGAATCCCAGGAGGGGCGG
TCCTAAGAATTTGCCAATTGCGGAGGTGTTGGTGGACGACGAAGACGGTG
AAGAAATGCTCAAGCAGAGAGATAAGCCCAGGTTGGTTGTTCTGGGATGC
GGCTGGGGATCAGTTTCTCTGTTGAAGAATATAAATCCGGATAATTACCA
TATCACTGTCGTTTCGCCGAGCAATTACTTTCTGTACACACCTTTGCTGC
CGAGCGCTACTGTTGGAACGTTGGAGCTCAGGTCCTTGGTTGAGCCGATT
CGGAGAATCACGAGTAGGGTGAAGGGTCACTTTCTTAAAGCTAATGCGGA
GGGGGTGGACTTCTCGGCAAAGTTAGTGGAGGTTTCCCAGACGCTGCCTA
GTGGGGAGGTGAGGAGATTTTATTTGCCTTACGATAAGCTAGTCATTGGT
GTCGGATCCAAAACTCGGACACATGGAGTCGAGGGCTTGGAGAATGTGGA
GTTTTTAAAGAATGTCGCGGATGCCAGGAAGATTAGGTCGAAGGTTATTG
AGTGCTTCGAGAGAGCCTGCTTGCCATCTACTACCGATGAGGAACGGAGG
AAATTGCTGTCGTTTGTGATTTGCGGGGGCGGGCCTACCGGAGTGGAGTT
TGCG

Sequences in the Contig:

SY0AAB2YB15FM1 SY0AAC33YB11FM1 SY0AAD52YM14FM1